SimpleSearch - Line and FST details


Line specific information

 
Line ID 276C02
Vector Used pAC161
Line Availability only available from NASC (N426426)
Segregation Analysis 50:46:45
Confirmed for Hit At1g15230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g15230

 
Sequence (A. th genome BLAST matches underlined)
>11-K015120-022-276-C02-8409
GCTTTGCCTGATGCTGCTATGCGGACTCCTACACTATAGTGACGCGTCGATATTCGACCA
CGAGGAGGAAGACGGTTGTTTAGCGGATCCTATTCCGGAAACTGCAGACAAGATTATCGT
TGGAGGAGACAATGAAAGGGATACTGGGCCGTGTTTAGCTGGAAAAGGCATTGAGAAGTT
GGCTGAATCGAAACAGGCCGGAGATTTGGTGGTGGCTGGCGAAGGAGAAGAAGGGAAGAG
CTGCGTTGATGGTTTGAAGGATCTATGGGATCCTCCCTTTAGTGA
GenBank Accession AL943678 [GenBank]
Graphic View Graphic view of gene At1g15230
Predicted Position of Insertion Chr1:5243067 - go to primer design
BLAST e Value 3e-122
Hit Clone Code (BAC ID) F9L1
Hit Gene Code At1g15230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL943679 [GenBank]


Last Updated on 31.08.2016 09:40