SimpleSearch - Line and FST details


Line specific information

 
Line ID 276F07
Vector Used pAC161
Line Availability only available from NASC (N426467)
Segregation Analysis 100:87:63
Confirmed for Hit At4g01420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g03090

 
Sequence (A. th genome BLAST matches underlined)
>54-K015120-022-276-F07-8409
CTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCTAGTCAA
TTTACCGAATACCCTCGATGATTGCATATTATCCCGACTCTCTCTGACGACGTGTAACAT
TTATAAGCTGAACGTATGAGATGTTTGACGGGCTATGGGAACCTCCATGAAGACAGATGG
GACCCTCCCATTAGAGAGTTCGTCGGAAAAATCACTCGATGCTCGTGAGATATATTTCCG
GCTCCGCATCGATGAAGCCTAAGGAGCAATGTATTGAGAAGATTTTGGTGGCGAACAGAG
GCGAGATTGCTTGCCGGATCATGAGAACGGCGAAGCGTTTAGGGATTCAAACCGTTGCGG
TTCACGGTGACGCTGATACAGATTCGCTCCATGTGAAATCTGCAGACGAAGCCGTACGGA
TT
GenBank Accession AL943738 [GenBank]
Graphic View Graphic view of gene At1g03090
Predicted Position of Insertion Chr1:739612 - go to primer design
BLAST e Value 4e-112
Hit Clone Code (BAC ID) F10O3
Hit Gene Code At1g03090 [TAIR] [MIPS] [SIGnAL]
Gene Annotation methylcrotonyl-CoA carboxylase alpha chain, mitochondrial / 3-methylcrotonyl-CoA carboxylase 1 (MCCA)
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At4g01420

 
Sequence (A. th genome BLAST matches underlined)
>54-K015154-022-276-F07-8409
CTGATCCATTGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATCTATCCAACGAAT
CTACAGTGAAAAAGTCATGATTAATCATATTTGACGGTTTCCCTCGACTCGTAGAAATCT
ATAGGCGAAAGATATGATGTTAGACGGGCTATGGGATCCTCCCTAGTATCCAGATGGGAT
CCTCCCTATAGTGA
GenBank Accession AL943739 [GenBank]
Graphic View Graphic view of gene At4g01420
Predicted Position of Insertion Chr4:580645 - go to primer design
BLAST e Value 7e-18
Hit Clone Code (BAC ID) F3D13
Hit Gene Code At4g01420 [TAIR] [MIPS] [SIGnAL]
Gene Annotation calcineurin B-like protein 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23