SimpleSearch - Line and FST details


Line specific information

 
Line ID 276G04
Vector Used pAC161
Line Availability only available from NASC (N426476)
Segregation Analysis 100:96:69
Confirmed for Hit At3g57390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g57390

 
Sequence (A. th genome BLAST matches underlined)
>31-K015120-022-276-G04-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGAAACA
AGAAGACACATAGAGACCCCTAAACAACCAGAATTAGAAAAATAATCGATTCCATCAATC
AGAAGCCACTTGACTCCCAGAGTTATCGCAGACCAGTTCGATCTTCGGCTTCTTTCTCTT
TGTGCAATACCCCGTCGACGACAACCTAAGAAAGATCAAACCAACAAGTTTGTAGAATGC
TCAGTAACAATAAAAGCTTGTAACAGAAGTTAGGGCTTTGTTTTGCAGTTTACCCCAACT
GCAAGGAAGTGTCGGAATGGTGCTCCTCGTTGTCATTCTCATCCTCTTCTGATGAAGAGC
TCTCGGGATCGGCTTCTGGGCTATGGGATCCT
GenBank Accession BX942919 [GenBank]
Graphic View Graphic view of gene At3g57390
Predicted Position of Insertion Chr3:21235795 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F28O9
Hit Gene Code At3g57390 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 18
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23