SimpleSearch - Line and FST details


Line specific information

 
Line ID 278B08
Vector Used pAC161
Line Availability only available from NASC (N426612)
Segregation Analysis 100:98:80
Confirmed for Hit At5g65510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g65510

 
Sequence (A. th genome BLAST matches underlined)
>58-K015156-022-278-B08-8409
TGATCCATGTAGATTTCCCGGACATGAAGCCCTTTAATAGGATTATATAACGTGCATCTT
CTTGCCTGTCCCACTGTAATGAGAGATGTCAGACTGTATTTACGGCGGTAATAAATACAA
AGATCCTTGCTGGATCATTTCGCAGAGAGTACTAACCCCTCCTATGTATTTACTTCATTC
TATGCGTATTATTGTTAGTCCTTTCTGTTTAAAATCGGGGTCTTTCCTTGACATTATGCC
CATATACCTTAGGCTATCAATCATCATGAAGAGTATACATATCACCTAGGAGGAAGGACT
TTTCAGCTGTTCATATGTATTGAATCCATTGCATGCATTGCTCTTGGCACTCTTTCTTTG
ACAAAACCTTTGTACTGCTTCCGCTTTTGTTTTCCCCAACCATAAAAGTTAAAGAATAAA
TGTTTGTTTTTAACCCAAGTCAAACTATGGGATCCTGCCTTGAGCGAGC
GenBank Accession BX890932 [GenBank]
Graphic View Graphic view of gene At5g65510
Predicted Position of Insertion Chr5:26187819 - go to primer design
BLAST e Value 1e-99
Hit Clone Code (BAC ID) K19O4
Hit Gene Code At5g65510 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AINTEGUMENTA-like 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g10010

 
Sequence (A. th genome BLAST matches underlined)
>58-K015122-022-278-B08-8409
TTGATCCATGGTAGATTTCCCGGACATGAATGCCTTTAGCATGGGACTATATCACTAGAC
TTCTCGCCTCTGCAAACTGTAAAAAAAGATAATCAAACAGTTTTTAAGGCGGGAATAAGT
AGAAAAATTCTTGCTAAATCATTTTGCAAGAGTTACTAACCCCTTCTATGGGATCCTCCC
TATCATGAGAGGCCGGGAAGTACATTGATGCGCCAAAACGATGATGTGCGGTATTTGAGA
GCGAGTGTACCTTATGCGACGAGGTGCGTTGGAGAGCATGCATGCCGACGCGGGAAGAGG
AGTCGGAGACTGTCCGAGGAACTGTATGGGTAGGATGCTGGTGGACAATTACCAGGAGAA
TAGCTCTAAGTAGAAATATGAGGACGGTATCAAAATGACTAATGTGATTGGTAACAGATA
CCTTGCAGAGCAGCAATGAGAGGTGGATTCCCTGTGAATGGCACATACTTCCAAACTAAT
GAGGTGATTTTCCCAGGAATGAATTTAACTTAAGCAGATGATCAAAAGCACCATTCTCGT
CAAAGCTCGATTGGGACTATACTTGTGCAGG
GenBank Accession AL943938 [GenBank]
Graphic View Graphic view of gene At3g10010
Predicted Position of Insertion Chr3:3083083 - go to primer design
BLAST e Value 5e-93
Hit Clone Code (BAC ID) T22K18
Hit Gene Code At3g10010 [TAIR] [MIPS] [SIGnAL]
Gene Annotation demeter-like 2
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23