SimpleSearch - Line and FST details


Line specific information

 
Line ID 278B09
Vector Used pAC161
Line Availability only available from NASC (N426613)
Segregation Analysis 50:50:49
Confirmed for Hit At1g09770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g09770

 
Sequence (A. th genome BLAST matches underlined)
>66-K015156-022-278-B09-8409
NTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACACTTGCTCATCGATCGTGCGT
CTGTAAAAGACCAAAGAACAAATCCAAAAACCCAACCAAACTCTGGTAAGCCGGTGGCTC
CCATTTGAAGTACACCCTATGGGATCCTCCCTATAGTGAGCAATCTCACCCTGCTTCAAT
GTCGCCTCTATTTGGGTCCACACGGTCTCTGCCCTCCTCTGTCAAATGTACAAATCCGTT
AAACATTGACACCAAACAAAATATAGTTTCAGAATTAACATTTAAGGCAATGTGGACTAT
ATGTTACCTCATGACCCTTTGTATAAGTTTTGTACTTGGCCTTCATGTGTTCTGCCTTCT
TCTCATCCTCCTCCATCTTTTATCTCACATTCTCCATCTCCTGCTGAAAAGCTGCAACTT
TGTCCGCGTTCCCAGCAACACTTGAGAGCTCGTAAGCGCTTCGAGTGGGGAAATACATGA
GATCATTCACGCATGTGTTGTGAGCTTCTACAAAATCATCAAGTGTCTTGTTCTCATGTC
CCCATTGACACACACAGAAACTTCCCCTCCTCCTTTATCATTTTGTCAGCCTACCCAAAA
TCCTAAGCAACAACCTTCATTTCAAAACTTCCTATGG
GenBank Accession AL943939 [GenBank]
Graphic View Graphic view of gene At1g09770
Predicted Position of Insertion Chr1:3164925 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F21M12
Hit Gene Code At1g09770 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cell division cycle 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23