SimpleSearch - Line and FST details


Line specific information

 
Line ID 279D02
Vector Used pAC161
Line Availability only available from NASC (N426726)
Segregation Analysis 90:62:46
Confirmed for Hit At1g69570
Parent of DUPLO pair 2709
Parent of pair(s) none

Gene hit At1g69570

 
Sequence (A. th genome BLAST matches underlined)
>12-K015123-022-279-D02-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATAACATTAATTAAA
GATCAAGCAAACATTAGTTTTTTTAGCCTTTATAACTCATAACAGAGAGAGAAAGTCTCA
AATTTTAGGGTTAAAAATTCAGATCGAGATCGACCCATTTGTAGATTCCCTCAGCCAAGA
AACATTTTATATATTCATCTGAGAATCATAAAGTTCGTTTATAGATTAATTAACACATAA
CACAAAAAAGAGGTTAGAATTCTCATGACATACCCTGATTGGTCCAATAGTTGGAGAACA
CGAAGATGAAGAAGAAGACGAATCCTCCTTGCTTGGATCAGAAGAAACATCGGGAACAGG
GGACAACGACGACGGATCATAACAATTCACATCTAAAAGAGATGTGATTGTCCTCCCAAA
CAACTTTATCTCCGTATCTCTATGGGATCCTC
GenBank Accession BX942925 [GenBank]
Graphic View Graphic view of gene At1g69570
Predicted Position of Insertion Chr1:26162837 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F10D13
Hit Gene Code At1g69570 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dof-type zinc finger DNA-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942926 [GenBank]


Last Updated on 14.10.2014 10:23