SimpleSearch - Line and FST details


Line specific information

 
Line ID 280F04
Vector Used pAC161
Line Availability only available from NASC (N426848)
Segregation Analysis 50:48:37
Confirmed for Hit At2g43550
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g43550

 
Sequence (A. th genome BLAST matches underlined)
>30-K015200-022-280-F04-8409
CTGATCCATGGTAGATTTCCCGTACATGAGAGCCTTTACATGTGGATTTTCTGTTATGCT
ATGTAGATGCCTTAGCTGTGTATACTCATACTATACCTATTGTGAATAATGCTCATACAA
TTCTATACGTCCGAGTCAGTCAGTATAACCGGTAAAAGGGAAGTAAAGGCAAACAGCTTT
TGAGCCTATGGGATTCTGCGTGTGAGTGAGATGGAGGANACGTGGGTCCACCGNNNTGTA
GCCCTATCTTCTTCCCCACGTTGTGCTCGGAAAACTGCCGGAGCTTGAAAGGTGCCAAAG
GCGGAGAATGCCTGAAGCAACCCGTACGGGAACATATCCTGTGCTTCTGCGACTACTGTA
AAGACGACTATGGGATCCTCCCTATAGTGAGNN
GenBank Accession AL944248 [GenBank]
Graphic View Graphic view of gene At2g43550
Predicted Position of Insertion Chr2:18073339 - go to primer design
BLAST e Value 8e-33
Hit Clone Code (BAC ID) T1O24
Hit Gene Code At2g43550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation scorpion toxin-like knottin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g30105

 
Sequence (A. th genome BLAST matches underlined)
>30-K015176-022-280-F04-8409
ACTTGATCCTGTAGATTTCCCGGACTGAAGCCTTTACTGTGAATTATCTGTGGACACTAT
ACAGGACTAGCTGGATATCCTATACAATACCTATCTCGCAAGTAATTCTATTGAGATTCT
TACCTATGAGGAGTCAGTATAACCGGTAAAAAGGAAGTAAAGGCAAACAGCTTTTGAGTC
TATGGGATCCTCCCTGTGAGTGAGATGGAGGGAACATCTGTGCTATGCTCCGTATACTGA
GATGGTGCCCGAAGTGTGGGCGTATCTAGTGAAAGAGCTTACAATGTGCGCACGGGGGGT
ATATGGCTGAAGCAAGGGACAGCCGCTCATATCAAGTGCTTCTGCGACTACTGTGAAGAC
GenBank Accession AL944247 [GenBank]
Graphic View Graphic view of gene At2g30105
Predicted Position of Insertion Chr2:12852071 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) T27E13
Hit Gene Code At2g30105 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LRR/ubiquitin-like domain protein
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40