SimpleSearch - Line and FST details


Line specific information

 
Line ID 280G04
Vector Used pAC161
Line Availability available as T3 set from NASC (N426860)
Segregation Analysis 50:50:46
Confirmed for Hit At1g19940
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g19940

 
Sequence (A. th genome BLAST matches underlined)
>31-K015176-022-280-G04-8409
NTTTGATCCATGGTAGATTTCCCGGACACTGAAGCCTTTACAATTGTAAGCTATGGAATG
CCCTGCACACCCTGTGTCCTCTGCATTTCTATGGGATCCTCCACTATAGT
GenBank Accession AL944259 [GenBank]
Graphic View Graphic view of gene At1g19940
Predicted Position of Insertion Chr1:6918886 - go to primer design
BLAST e Value 6e-09
Hit Clone Code (BAC ID) F6F9
Hit Gene Code At1g19940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glycosyl hydrolase 9B5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37