SimpleSearch - Line and FST details


Line specific information

 
Line ID 282G02
Vector Used pAC161
Line Availability only available from NASC (N427050)
Segregation Analysis 100:66:52
Confirmed for Hit At4g20410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g20410

 
Sequence (A. th genome BLAST matches underlined)
>15-K015177-022-282-G02-8409
ACATGAAGCACTTTACAATTGAATATATCCTGAATCCGATTACTGTTGCTATATCTGAAT
ACATACGGCATGCTAATAGGCGTGATCTGGTTCTTCTCCTCGAGAAAGGCTCAGGACTCT
ACACTGGAGTCTAAAACTATAATAATAGGCTGAAGATGGAAATCAAACGTGGAATCTCCT
ACACATGCTACCAGACTCTACAATATCCACTGTATAAATTACAACACCATTTGACTCCAA
ACATCATCGAACAAACAAACAACTTCAAAACAAAAAGAACAACCATCTCTTGTTAAACAC
TCCAAAATCAGCTACAATGTCAATTTCAAGAGTTTATCTCTGTCTAATCTTTCTCACATT
CGTCAGTTCCCCACTTGTGCTCTGCTCTCGCAGCCCGAAACTCGCAGCAGCATCAGCAGC
AATAGGGAAGAAGCATGGGAAAGAACATGTTCATTCTCCGGCAATGCTTTTTTCTGAATT
CCCGAAGGTTGATTCATCATCCTCCATGACACAATATTGATGAGCCCTGCACANAGTCTG
CAATAGCCCGGTTTTTCAGGTATAGACTACCATTCCAGGGATGGCCTTTTCACAAGTATG
CTCCTTTTCCAATGGGTACACCTACGAATCCTTCCGTTCCTGTAACTTCAACACCGTCTT
CTGGAGCTGCTGCTGCTGAGGAGAAGAAACCGGAAAAAGTGCCTTTGCGCCAACCAAAGA
AACAGAGATGGAGGCAATGCCTAATGGAACAATATGTTTTCT
GenBank Accession AL944513 [GenBank]
Graphic View Graphic view of gene At4g20410
Predicted Position of Insertion Chr4:11016757 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F9F13
Hit Gene Code At4g20410 [TAIR] [MIPS] [SIGnAL]
Gene Annotation gamma-soluble NSF attachment protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL944514 [GenBank]


Last Updated on 14.10.2014 10:23