SimpleSearch - Line and FST details


Line specific information

 
Line ID 282H08
Vector Used pAC161
Line Availability only available from NASC (N427068)
Segregation Analysis 50:34:34
Confirmed for Hit At5g09330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T13L16

 
Sequence (A. th genome BLAST matches underlined)
>64-K015202-022-282-H08-8409
CTGATCCATGTAGAATTTCCCTNACATGAANGCCTTTACTAATTAGACCATTAATATAAT
TTGATATAAGGCTGTCAAAAAATGGAAATAGCAAAATCTAAAATAACGTCAGATTATTTA
TAATGCGAAACATTACATACTCAGAAATCTTCAATACATTTGATACGTATCTGGTATCTG
ATTTAAAAGAACTTATTATTCCTATGGGATCCTCCCTATAGTGAGAGANAAAAAGAA
GenBank Accession AL944537 [GenBank]
Graphic View Graphic view of sequence AL944537 of line 282H08
Predicted Position of Insertion Chr2:7753538 - go to primer design
BLAST e Value 8e-89
Hit Clone Code (BAC ID) T13L16
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g09330

 
Sequence (A. th genome BLAST matches underlined)
>64-K015177-022-282-H08-8409
NTGATCCATTGTAGATTTCCCGGACATGAAGCACTTTACACTTGAATATATCCTGAATGC
AAAAAAAAACTATCCATCAAATAGATCCAACATTGAATATAAGTCATCATTGTTGGGGGT
CTGAACGGTCTCTGCCAGAGGTGCACCATACATAGGAGTGGTAGCTGCATCACTTGGATG
TGGAAGCTCGCTGGCGGTATATATTGTAGCTGGTAGGAAATCCGAGACACATGACTCTGA
TATCATGCCACCAAAACAATCCTTATTGGAGTCATCTGGGGCAGTCAAAGCCAGAGTGGT
TTCTTTGCTATGGGATCCTCC
GenBank Accession AL944536 [GenBank]
Graphic View Graphic view of gene At5g09330
Predicted Position of Insertion Chr5:2893527 - go to primer design
BLAST e Value 6e-114
Hit Clone Code (BAC ID) T5E8
Hit Gene Code At5g09330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 82
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40