SimpleSearch - Line and FST details


Line specific information

 
Line ID 283B06
Vector Used pAC161
Line Availability only available from NASC (N427090)
Segregation Analysis 50:50:35
Confirmed for Hit At1g02120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g02120

 
Sequence (A. th genome BLAST matches underlined)
>42-K015178-022-283-B06-8409
NTGATCCATGTAGATTTCCCGGACTGAAGCACTTTACAATTGAATACTTCCTGATCATGT
GAATCTATAAATTGTTTGAGATTTAAATCGCGTCATGGGAAACGGTCTCTTAATGGTTTT
GCTAAATAAGGCCTATCAGGATGGGGTAGCTTAGCTTTATGATCTTGTCTTTTGGTGCTA
CTTCACAAGTTGCGCTATGGGATCCTCCCTGTAGTGAG
GenBank Accession AL944563 [GenBank]
Graphic View Graphic view of gene At1g02120
Predicted Position of Insertion Chr1:397395 - go to primer design
BLAST e Value 1e-50
Hit Clone Code (BAC ID) T7I23
Hit Gene Code At1g02120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAM domain family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL944564 [GenBank]


Last Updated on 07.07.2016 14:03