SimpleSearch - Line and FST details


Line specific information

 
Line ID 283D09
Vector Used pAC161
Line Availability only available from NASC (N427117)
Segregation Analysis 50:50:42
Confirmed for Hit At4g28520 At1g63370
Parent of DUPLO pair none
Parent of pair(s) 1658, 3397, 91874, 91882, 91891, 91898, 91908, 91918, 91919, 91920, 91921, 91922, 91923, 91924, 91925, 91926

Gene hit At4g28520

 
Sequence (A. th genome BLAST matches underlined)
>01-K106829-0022-283-D09C-3144
CACTATCCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAG
GGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTGAATAT
ATCGAGGTTCATACATGATAATTACCCTTCCAATAAAATTAATGTATATATCATGTCTAA
TTAATGAAGATATAATCGATTCACCATATGATAACTCTTTTTTTTCCTCTCTACCTAAAA
TTAATTTACAGGAACGGGTATCAGCGGAAGAGTGGTCCCTGGATGTGCCGAGACCTTCAT
GGACTCGCAGCCGATGCAAGGACAACAACAAGGCCAACCATGGCAAGGACGACAGGGACA
ACAAGGCCAACCATGGGAAGGACAGGGACAACAGGGACAACAAGGAAGACAAGGCCAACC
ATGGGAAGGACAGGGACAACAGGGACAACAAGGACGACAGGGACAACAAGGCCAACCATG
GGAAGGACAGGGACAGCAGGGACAACAAGGGTTCCGTGACATGCACCAGAAGGTGGAACA
TGTGAGACGCGGAGACGTCTTTGCCAACACTCCAGGCTCTGCCCACTGGATCTACAACTA
CAGAAGAACAG
GenBank Accession HG968866 [GenBank]
Graphic View Graphic view of gene At4g28520
Predicted Position of Insertion Chr4:14087898 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20O9
Hit Gene Code At4g28520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cruciferin 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL944606 [GenBank]

Gene hit At1g63370

 
Sequence (A. th genome BLAST matches underlined)
>68-K015178-022-283-D09-8409
TTGTCCATGTAGATTTCCCGGACTGAAGCACTTTACAATTGTATATTCTAGTTACACGCA
TCCCCTGAACACCTTAGAGATAGGTACTTATTTTATTGATCTAATGTTTAATTCTCTTGC
ATAATTGGATTGTGCTGGCAACGATTATGTTGCTGTGCTTATTGGGAACTCTTCAAGTGC
TGAGGATATAAGTAGGGACATTGCTATGGGATCCTCCCATTAGTGAG
GenBank Accession AL944605 [GenBank]
Graphic View Graphic view of gene At1g63370
Predicted Position of Insertion Chr1:23504349 - go to primer design
BLAST e Value 7e-49
Hit Clone Code (BAC ID) F9N12
Hit Gene Code At1g63370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Flavin-binding monooxygenase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23