SimpleSearch - Line and FST details


Line specific information

 
Line ID 283F11
Vector Used pAC161
Line Availability only available from NASC (N427143)
Segregation Analysis 100:91:87
Confirmed for Hit At1g65620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g65620

 
Sequence (A. th genome BLAST matches underlined)
>86-K015203-022-283-F11-8409
TTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATTGACAGGGAAA
ACAGAACACATGAAAAACTCCATTTTCAGGTATTAAAATGGCATCTTCTTCACAAACTCA
CCATGCGCCGCTTGCGAAATCCTCCGGCAGAAAATGTCAACCGGAATGTGTATTCACGCC
CTATTTCCCACCGGACCAGCCACAAAAATTCGCAAACATTACACAAAGTGTTCGGAGCAA
GTAACGTGACAAATACTCCTCAACGAGCTTCACCCTTCACAACGTGAAGACGCAGTGAAC
TCTTTGGCCTATGAAGCCGACATGCGCCTCCGTGACCCTGTCTACGGCTGCGTCGGCGTC
ATCTCTCTCCTCCAACATCAGCTTCGTCAGCTTCAGATAGATCTCAGCTGTGCTAAATCT
GAGCTCTCTAAGTACCAAAGCCTCGGTATCCTCGCCGCCACTCATCAGAGTCTTGGCATC
AACTTACTCGCCGGAGCAGCAGATGGAACAGCCACCGCCGTGAGAGACCACTATCACCAC
CACCAGTTTTTTCCTATGGGATCT
GenBank Accession CR770327 [GenBank]
Graphic View Graphic view of gene At1g65620
Predicted Position of Insertion Chr1:24400106 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5I14
Hit Gene Code At1g65620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Lateral organ boundaries (LOB) domain family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40