SimpleSearch - Line and FST details


Line specific information

 
Line ID 284F04
Vector Used pAC161
Line Availability only available from NASC (N427232)
Segregation Analysis 100:87:70
Confirmed for Hit At3g06710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g06710

 
Sequence (A. th genome BLAST matches underlined)
>30-K015289-022-284-F04-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCTTAT
TGAACCAATCCATCTTGAAGCAGCCCATTGAAGGAAGCTTATTGATTCCCACGTTTCTGA
TTCTCTTGAACTTTCCCCGCCATGCCTTAGTCGCGAAACTGTTGACAGGAAACGAGATTT
TTGCTCAGGAGGCAGGACAGTTTCTTTGTTATGAAGTGATATCCCAAGGAAAACCACCTG
ACTATGGCTGGAAACGAGATTTGACGCAGAGTGAGGAAAATTCCTAAGTAGGCAAAGGGA
ATTGACAGCGTCATCATGTATCCAAGAATGACAGGTGAGTTTTCGAATAAACCGCCACCT
CCTACAATTGCTATTGCAATCCAGCGAAAAGAAAACGGCAGAAGAATAAAGAAGAAAGAC
ACACATATGCTGATGGTAAGAGCCTGTAGATAAGATAACAAACAGAACCTGTTATTCAAA
ACATGCTCCATATGGTAATTAAGTTACATAGGGTGGACGAAGGAAGAGAACTATGGGATC
CTCCTTTNNNNGGAGANNNNNATTTGTTATCCATAAAGAAAAGCACGCGTCCAATGGCTC
CAAGTTCGTGAACAGCAACACCAACTAGCCTA
GenBank Accession AL944755 [GenBank]
Graphic View Graphic view of gene At3g06710
Predicted Position of Insertion Chr3:2119703 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T8E24
Hit Gene Code At3g06710 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23