SimpleSearch - Line and FST details


Line specific information

 
Line ID 284F04
Vector Used pAC161
Line Availability only available from NASC (N427232)
Segregation Analysis 100:87:70
Confirmed for Hit At3g06710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g06720

 
Sequence (A. th genome BLAST matches underlined)
>30-K015276-022-284-F04-8409
NTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACAATTGAATTAATCTTGTCCCT
CGCTCCCTCTGCTTGTTAACTCTTTCTTTATACTTTTCCTCTCCCAATCAACTTTTAGGT
TTTTTTTATAACTATAAGCCATTGGCTCTCGGCGGGATCTATATAATACGACACCACCAG
TCTTGGTGTGGGCTCGTGAGCATTCATTGATCGGGTTTATATCTTTTCATGGGATTCTCT
TTGCCGAGCATGAGCCATGTAACTGACACCCAACGCTGAAACGGAGGTTCGCCGGAACCG
ATACAAAGTTGCAGTGGATGCTGACGAAGGACCACGGGAGAGATAAGACAACACTGGCTG
ATATCCCTATAGCCATGCGTGAGGAGAGTTTGATGAACAGCAGACGAGTAGGTATGCAAG
ATCTTCA
GenBank Accession BX890933 [GenBank]
Graphic View Graphic view of gene At3g06720
Predicted Position of Insertion Chr3:2120354 - go to primer design
BLAST e Value 1e-74
Hit Clone Code (BAC ID) T8E24
Hit Gene Code At3g06720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation importin alpha isoform 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890933 [GenBank]


Last Updated on 31.08.2016 09:40