SimpleSearch - Line and FST details


Line specific information

 
Line ID 285E05
Vector Used pAC161
Line Availability only available from NASC (N427317)
Segregation Analysis 100:92:75
Confirmed for Hit At3g59100
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g57880 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g59100

 
Sequence (A. th genome BLAST matches underlined)
>37-K015290-022-285-E05-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTTTGAAT
ATAATATTATTAAAGACCATATGTCAAAATCATTGTGATAACTACAACACATGAGTGTGA
TGAGAGTGTGAGGTGTCCAAGTCCAACCAAACTAAAATATCCCTATAACCTTATAGACAT
CTATTGAACTACGCTAAAACGACACCGTTCTAAAGAAGCAGGTTTGTTGCTTAAGACAGA
AGAAACCCGGAAACAACACTGAGTATTTATGGTTTTACTTGTGCGAAGAAGTTGCTTTGT
CTTTCCGACCAGCGAGAATCATAGAGATTTGAAGGCCTCTGCTAAAAGCTTGATTGAAAA
GCAGACGAGCTTGAAACTCGGAGACAATGGGAAACCAAGACAGAACAGCGATTGGTGCAA
AGATTACAAGTCCCATGATATTCTCATACGCTCTTCCTATGGGATCCT
GenBank Accession AL944883 [GenBank]
Graphic View Graphic view of gene At3g59100
Predicted Position of Insertion Chr3:21854076 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F17J16
Hit Gene Code At3g59100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glucan synthase-like 11
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g57880

 
Sequence (A. th genome BLAST matches underlined)
>37-K015277-022-285-E05-8409
TGCCGGGATCGATCATATAGCAATCGCGGGTGAACCGTCAGCTCGTACCAGGATTCTTGC
CTTATGTGATCTCGCAGTACATCCACTCACCTATGGGATCCTCTCTATATGTGAGTGTAC
AGCTAGAAACGATTGTTCAACTTCTAATCCACTATCTGGGCGTACTTAGCACACATTATG
CATCAGCAGTTACCAAGCCGTATTTGGATCTATATGCATAAAACCTGCAGCATTCAATAA
CCCCAACTCCAGTACACCAATATTAAGCTTCCATAATAGCTTCGCTGCTGGGCTAAGATC
ACTGCTGAAATGCGTACGACTCATCGACAACGTGACACCCTCCTTCCAAACATATACTCA
TGTGAATGCTGCTATGGCATCCTCCATAAATTGAGCATACGCTCTTCCTAGGGGATCCTA
CCTA
GenBank Accession AL944882 [GenBank]
Graphic View Graphic view of gene At3g57880
Predicted Position of Insertion Chr3:21432181 - go to primer design
BLAST e Value 2e-42
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g57880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 285E06


Last Updated on 07.07.2016 14:03