SimpleSearch - Line and FST details


Line specific information

 
Line ID 285E06
Vector Used pAC161
Line Availability only available from NASC (N427318)
Segregation Analysis 50:45:30
Confirmed for Hit At3g57880
Parent of DUPLO pair none
Parent of pair(s) 3716, 3780, 8303, 96671

Gene hit At3g57880

 
Sequence (A. th genome BLAST matches underlined)
>45-K015277-022-285-E06-8409
NTGATCCATGTAGAATTTCCCGGACATGTAGATTTCCCGATTCTTGAATCTTTTGCTCCT
CCAATCTTCTCACCTCCATGGAGATGGCAGTTATCAAAAACTCCACAGTAACAACGGTGC
ACGGATCAAAAACCTCCCAAGTATATTGCTCATTCCATCTTGGTGTAAAGCTGTCAATGA
TTGTCCGAGTTCGAATCCATTTCTGTCCGTACTTCGCCACACAATATGCATCTGTGGTTC
CCCGGCCGTCTTTGGTTTTCATAGGCATCAGACCTGTAGCATTCAGTATCCCCAACTCCA
GTACACCGATATTAGGCTTCCATAGTTGCTTCGCTGTTGGTCTAAGATCACTGCTGTAAT
GCGTAGACTCATCGAGAACGTGATACCCTCCTTCCAAACATATTCTCATGTGAATCCTGC
TATGGGATCCTC
GenBank Accession AL944884 [GenBank]
Graphic View Graphic view of gene At3g57880
Predicted Position of Insertion Chr3:21432162 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g57880 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23