SimpleSearch - Line and FST details


Line specific information

 
Line ID 285E09
Vector Used pAC161
Line Availability only available from NASC (N427321)
Segregation Analysis 100:97:74
Confirmed for Hit At2g46510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g46510

 
Sequence (A. th genome BLAST matches underlined)
>69-K015277-022-285-E09-8409
NTGATCCATGTAGAATTTCCCGGACATTGAAGCCTTTACAATTGAATATATCCAATAGCT
GGTTGCGTAACTCTCCTCATGAACAAAGCTTGAACAGACTTAACCAAGCCAATGTTTTCA
GGCAAAGACCAAACAGAACCAAGCTCAAGAACACCAGCATCAGTAGGAACCATAACGATC
GTTCTGATTCCCGCAGATTTCGCCATAAAAGACCTGAAACAATAGTCAGACTCAGAGTTA
ACTGCATCAGAGAGCCACACATGTTTCCCTGAAGAATAACACCTCCCAGGACCGCCTTCA
CCGTGATTGAAGAAGAAATACATGGAAGCTAAGAAGAAAATCTCAGTAGCAGTAACTTTC
TCTAAGCTCAAAGCATAATTGTCTTCATCAGATCCACCAAACAACCTATGAAGCTTCTGC
AACACTCTCTTCCTCATATCTTGCCATGTCTCTTCCTCTGCCCCCATGTTGTTAAAATTA
TAAGACCTAACAACTTTTGATTCCTCTTCCTCATTAGGCTCTCGACAACACCCATCTCCC
CAACCTAAGACTTGTTGTCCGGATCTATGGGATC
GenBank Accession BX890940 [GenBank]
Graphic View Graphic view of gene At2g46510
Predicted Position of Insertion Chr2:19092149 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11C10
Hit Gene Code At2g46510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABA-inducible BHLH-type transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890940 [GenBank]


Last Updated on 31.08.2016 09:40