SimpleSearch - Line and FST details


Line specific information

 
Line ID 285G08
Vector Used pAC161
Line Availability only available from NASC (N427344)
Segregation Analysis 50:39:18
Confirmed for Hit At5g01840
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g17930

 
Sequence (A. th genome BLAST matches underlined)
>63-K015277-022-285-G08-8409
CTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGATGGC
TTCATTCAGCTCCGGTTCCAACGATCAAGGCGAGTTACATGATCCGCCATGTTGTGGTGA
TATACGCCATGCCGGCTATGAAAGAAGCAATACAGCGTACCTTTACAAGGAAAAAAAATG
TTCAGCAATATATTGACTAATAAGGGCGTCAATGTAGTCATGTAGTTCCACACATGACTA
TAGGGCTATGGGATCCTCC
GenBank Accession AL944924 [GenBank]
Graphic View Graphic view of gene At5g17930
Predicted Position of Insertion Chr5:5942326 - go to primer design
BLAST e Value 9e-42
Hit Clone Code (BAC ID) MPI7
Hit Gene Code At5g17930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MIF4G domain-containing protein / MA3 domain-containing protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At5g01840

 
Sequence (A. th genome BLAST matches underlined)
>63-K015290-022-285-G08-8409
CTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATAGGCCCACATAAT
CTAACACAAAATCAATGAACACGGAGACAGCATCTCACTCACCTTATAATAACCTTTATA
TATTACACGTATGTGGGCCCACTCACATAAACCTCTCTTTCCTTTATAAATCCTCCACTC
TTCACACTCTCACTTTTGTTCATGTACCAAAGAAGTCCCCAACAAACACAAAATAATCAA
CAGAGAGAGTCAGAGAGATAATGGGTAATAACTATCGGTTTAAGCTATCGGAGTTAATCC
CTAACGCTTGGTTTTACAAACTTAGAGACATGTCCAAATCCAAGAAGAAGAATCTTCAGA
GCCAACCAAATAGCACCACCTCCAAGAAGAAACACCACGCAGTCCCTACTCCTACGTCCA
CAACGCCACTCAGTCCTATGGGATCCT
GenBank Accession AL944925 [GenBank]
Graphic View Graphic view of gene At5g01840
Predicted Position of Insertion Chr5:324340 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20L15
Hit Gene Code At5g01840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ovate family protein 1
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03