SimpleSearch - Line and FST details


Line specific information

 
Line ID 286A06
Vector Used pAC161
Line Availability only available from NASC (N427366)
Segregation Analysis 50:50:38
Confirmed for Hit T22O13 At5g24520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T22O13

 
Sequence (A. th genome BLAST matches underlined)
>41-K015496-022-286-A06-8409
NTTTTGATCCATGTAGCATTTCCCGGACCATGAAGCCTTTACAATTGAATATATTCCGGA
GCAGCCCCACTGTCATTGCTTACTAAAGAACATTATTTAACTGCTTACATGTATAGGTAA
CCGATGGACTGAATCTTCTATATGTACTGGTGATAAAGTGGAGAATGAGCCTGACGACAT
GCAGCTGCTTACAGCACTGAGGTGAGAGTTTCTGTCTCGCTCATAGTGCTCATTTGCTA
GenBank Accession FR807214 [GenBank]
Graphic View Graphic view of sequence FR807214 of line 286A06
Predicted Position of Insertion Chr2:11617879 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) T22O13
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g24520

Sequence (A. th genome BLAST matches underlined)
>41-K015494-022-286-A06-8409
AATTTGATCCATGTAGATTTCCTGGACATGAAGCACTTTACAATTGAATATATATCCTGA
GCTGCACCACTTTCATTGATTACTAAAGAACAATATTTAACTGCTTACATGTATTAGGTA
TCCGATTGACTGAATCTTTTATATGTACTTGTGATAAAGTGGATAATGATCCTGACAGAC
ATGCAGCTATGGTGATCCTCCTTTAGATGAGTTCTGTTTCGCTACATAATTCTCATTTGC
TATGGGATCCTCCCTTNAGTGAG
GenBank Accession AL944953 [GenBank]
Graphic View Graphic view of gene At5g24520
Predicted Position of Insertion Chr5:8371851 - go to primer design
BLAST e Value 2e-08
Hit Clone Code (BAC ID) T31K7
Hit Gene Code At5g24520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Appelhagen et al. 2014, ttg1-22]


Last Updated on 07.07.2016 14:03