SimpleSearch - Line and FST details


Line specific information

 
Line ID 287E03
Vector Used pAC161
Line Availability only available from NASC (N427507)
Segregation Analysis 100:98:93
Confirmed for Hit At5g62440
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g62440

 
Sequence (A. th genome BLAST matches underlined)
>21-K015278-022-287-E03-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCAAAAATACAATAGACCGAACCAGTTC
GGTTCAATCGGAAACCAAAGTCTATAAATATACCGCTTAGACGTTTTCTGTAGGTCACAC
CCCCTCAAGCTTAAACCCTAGACTCTTTTGGTCTCGGTGTAACGGAAGACCTTTTTGGTC
GCTCACGTTGGACTTCCTGGTAGGATCCGGGTCACGTGAGCCGTGGGGCGGAACTTATCG
CGATCGGCATTGGCGCTGACTACGAACGACCCACTCGCCTGGATATATGAGAAGCGCAAT
CACCATCTCTGAAACCCTCGCGAGATTTCGCAGTGCGCGACTCCAGAGACCGAGGGTTAG
ATCATGCCTATGGGATACCTAAACTTTTTAGATGTTCACTCTGTCGGGATATCTTGGAGA
CTTAACTTATTGATCAATCACAATTTTTGCCACAGAGGAAAATGTCAAAGTCAAACGAAC
ATCTTTTGAAATTATTTACATCTCGTGGAATTAATGGAACTTCTTAAATTTTTCAAAAAT
TTGACATAATTGGAATATATTATTTTTGCTTCTATGGGATCCT
GenBank Accession AL945166 [GenBank]
Graphic View Graphic view of gene At5g62440
Predicted Position of Insertion Chr5:25074097 - go to primer design
BLAST e Value 5e-102
Hit Clone Code (BAC ID) K19B1
Hit Gene Code At5g62440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation EMB514 (DUF3223)
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL945167 [GenBank]


Last Updated on 31.08.2016 09:40