SimpleSearch - Line and FST details


Line specific information

 
Line ID 288G04
Vector Used pAC161
Line Availability only available from NASC (N427628)
Segregation Analysis 50:38:31
Confirmed for Hit At2g23480
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g23480

 
Sequence (A. th genome BLAST matches underlined)
>31-K015346-022-288-G04-8409
TATATNGTAAAATAGGAGTATCTGTGTAATACTGGTAATTACGGGGAATACTTTTAGGAA
ATACAAGTAATAATGTGGCAGTACTATTTACAATTGAGTGATATATGAATAGGAGTATCT
GTGTAATACTGGTAATTACGGGGAATACTTTTTGGAAATACAGAGTAATAATGTGGCAGT
ACTATTTACAATTGAGTGATATATAAATGAATGTTTGTTTCTTTCAGGATATGGAGGAAG
CGATGGCAATGCAGCCACTTGGTATGTACTTCCCGGCGTCGGAGTATACCAAGAAGATGA
AGTTAGCAACGAGGTGTTATATCTCGGAGGTGTTGAAGACCTTCGCTGACTTGGAACATC
CTCTAACGAATGTTGAAAAGAATTATTTTATGGAGCATCCGAGTTTCAAGCACATCTACC
ACCTGCCTTCCGGATATACCCACAAGTTAATGGGGATGTGGATGCTTTTTCTTCGAACGG
CATCTATTGAGAAGAAGAAGGAGGTTTGGTTCGTTGTTAATGGAGTTCCCATCCGCTATG
GTATTAGGGAGCATGCTTTGATCTCTGGTTTCAACTGCAAGGCTTATCCAGCTAATTATC
AGAGTGCTGGTAATATGAACTTCGCCAACAGGTACTTCAAAACCGGGGTAATTAGACGTG
AAGACGTGAAAACCAAGCTAATGGAAATGGAACCGGCTA
GenBank Accession AL945357 [GenBank]
Graphic View Graphic view of gene At2g23480
Predicted Position of Insertion Chr2:10003001 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F26B6
Hit Gene Code At2g23480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transposable element gene
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03