SimpleSearch - Line and FST details


Line specific information

 
Line ID 288G04
Vector Used pAC161
Line Availability only available from NASC (N427628)
Segregation Analysis 50:38:31
Confirmed for Hit At2g23480
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g23480

 
Sequence (A. th genome BLAST matches underlined)
>31-K015351-022-288-G04-8409
TTCTTCCCCATAGACGACGCCTTTGACAGCGAGTTTAACAGATACTTCCAGAGACGACGC
CTTTAACACGAATTCTCTCCAGTTCACGTAATTCTTTGATCTCATATCCTTCTATTCAGT
CAATGCCCGATCGATTCCGCTACTATCTCTTGAGTTCCCATTACTCTGAGAAACCCTATG
GGATCCTCCCTATAGTGAGATATAAATGAATGTTTGTTTCTTTCAGGATATGGAGGAAGC
GATGGCAATGCAGCCACTAAGATGGTACATTTCGGCAGGTTGTCTTTCGCCTGCCAATGG
ATTCACCACCAGGTGAAAAGGTTAACCTATGCGGGAAACTTCGGATGTACGCTTATTTTC
AACTCCCAGAGGCATTTCGACGCTTACTACGCCCTTTCTCGTCTCTGGGTGCCTATGGGA
TCCTCCTAGGATGATGCCCACAAGTTAATGGGGATGTGGATGCTTTTTCTTCGAACGGCA
TCTATTGAGAAGAAGAAGGAGGTTTGGTTCGTTGTTAATGGAGTTCCCATCCGCTATGGT
ATTAGGGAGCATGCTTTGATCTCTGGTTTCAACTGCAAGGCTTATCCAGCTAATTATCAG
AGTGCTGGTAATATGAACTTCGCCAACAGGTACTTCAAAACCGGGGTAATTAGACGTGAA
GACGTGAAAACCAAGCTAATGGAGATGGAACCCGCTATGGGATCC
GenBank Accession AL945358 [GenBank]
Graphic View Graphic view of gene At2g23480
Predicted Position of Insertion Chr2:10003042 - go to primer design
BLAST e Value 3e-143
Hit Clone Code (BAC ID) F26B6
Hit Gene Code At2g23480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL945358 [GenBank]


Last Updated on 31.08.2016 09:40