SimpleSearch - Line and FST details


Line specific information

 
Line ID 290F09
Vector Used pAC161
Line Availability available as T3 set from NASC (N427813)
Segregation Analysis 100:96:72
Confirmed for Hit At5g45800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g45800

 
Sequence (A. th genome BLAST matches underlined)
>70-K015353-022-290-F09-8409
ATTAACTCTGTTAAATAGTGAATTCGAAAGTAATAGCCTATGGGATCCTCCCTATAGTGA
GAGGAAACT
GenBank Accession BX942931 [GenBank]
Graphic View Graphic view of gene At5g45800
Predicted Position of Insertion Chr5:18576608 - go to primer design
BLAST e Value 4e-04
Hit Clone Code (BAC ID) MRA19
Hit Gene Code At5g45800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37