SimpleSearch - Line and FST details


Line specific information

 
Line ID 291A08
Vector Used pAC161
Line Availability only available from NASC (N427848)
Segregation Analysis 100:97:70
Confirmed for Hit At4g31550
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g31550

 
Sequence (A. th genome BLAST matches underlined)
>57-K015354-022-291-A08-8409
TTCTGATCCATGGTAGATTTCTCGGACCATGAAGCCTTTACAATTGAATATATCCTCTCC
AAAATCCTCAGACCAAGAAATCATCATGGCCGTCGATCTAATGCGTTTCCCTAAGATAGA
TGATCAAACGGCTATTCAGGAAGCTGCATCGCAAGGTTTACAAAGTATGGAACATCTGAT
CCGTGTCCTCTCTAACCGTCCCGAACAACAACACAACGTTGACTGCTCCGAGATCACTGA
CTTCACCGTTTCTAAATTCAAAACCGTCATTTCTCTCCTTAACCGTACTGGTCACGCTCG
GTTCAGACGCGGACCGGTTCACTCCACTTCCTCTGCCGCATCTCAGAAACTACAGAGTCA
GATCGTTAAAAATACTCAACCTGAGGCTCCGATAGTGAGAACAACTACGAATCACCCTCA
AATCGTTCCTCCACCGCCTATGGGATCCTCC
GenBank Accession BX890947 [GenBank]
Graphic View Graphic view of gene At4g31550
Predicted Position of Insertion Chr4:15291491 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3L17
Hit Gene Code At4g31550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 11
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40