SimpleSearch - Line and FST details


Line specific information

 
Line ID 292A11
Vector Used pAC161
Line Availability only available from NASC (N427947)
Segregation Analysis 50:47:35
Confirmed for Hit At4g36710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g36710

Sequence (A. th genome BLAST matches underlined)
>81-K015437-022-292-A11-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATTTCGTTCTGACTA
TTGACCGACTGCTCTGAGTAAGCACGCATATATTTCGTCGTCTACGTGGCATACCTGATC
TGGATACCAATTTATCGGATAGTACTCACCTATTGATCGTTGTATTCTTGTGATTATGAA
AGATGGACTGACATCGCCGGATCTGGATCATTCCGGCGAGAGTTTGTTTACGCTCTTGAC
TTCTACACGATGGTGCTGGAGTCGCTCGACGCTGCAGCTCCTCCCGGAGATTTGGTGAAG
AAGATAGTGGAAGCGTTCGTACTACTACCGAAGATCTACGGTGCGGTAGAAACGGCGGCT
GACAGGAGACACACCGGCGAAATGACTTGTCGGGAAGCGTATTGCGCCGCCGAGATGATG
CCTACTCAGCTAAGCCAGTTCGCCGACTTTCAAGCTGAGTGTCTATTGGATAAAGCGCAA
GTTAGAAGATCCCACCTGCCCATACGACAAGGAGACTTGGTGC
GenBank Accession AL945817 [GenBank]
Graphic View Graphic view of gene At4g36710
Predicted Position of Insertion Chr4:17307006 - go to primer design
BLAST e Value 8e-135
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g36710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Lee et al. 2008, scl15-1]
Other FSTs Supporting this Hit AL945818 [GenBank]


Last Updated on 07.07.2016 14:03