SimpleSearch - Line and FST details


Line specific information

 
Line ID 294B06
Vector Used pAC161
Line Availability only available from NASC (N428146)
Segregation Analysis 50:49:35
Confirmed for Hit At2g34470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g34470

Sequence (A. th genome BLAST matches underlined)
>42-K015439-022-294-B06-8409
NTGATCCATGTAGAATTTCCCGGACCATGAAGCCTTTACAATTGAAGATATCCGTATCAA
TTTGGGTCCTCTTGAGGAGTTATCTAACTTATTCAAGGCTGATTTGCTTCTTTGTGAATC
CGGTGGAGGTGAGGTTTCATTTCTAGCTATGGGATCCTCCCTATAGTGAGANNNNANNNA
NNNNNNNCCCCCNTTTTTTTCATTCAAAAATGTATACGCCCGCCCCCTCCTTATACCCAN
CCCCTCCCATCCTCCCTCTAAAACATTCATTTTCCCCCCCCCCCACAACCCACACTTAAT
CCAACAATTCACACCAATNACCACTTNCAATCCCAATAAAAAACCACTAATATCTTAAAC
TACACACAAACC
GenBank Accession AL946106 [GenBank]
Graphic View Graphic view of gene At2g34470
Predicted Position of Insertion Chr2:14531591 - go to primer design
BLAST e Value 3e-51
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34470 [TAIR] [MIPS] [SIGnAL]
Gene Annotation urease accessory protein G
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Witte et al. 2005, ureG-1]


Last Updated on 14.10.2014 10:23