SimpleSearch - Line and FST details


Line specific information

 
Line ID 295B01
Vector Used pAC161
Line Availability only available from NASC (N428237)
Segregation Analysis 50:40:25
Confirmed for Hit At2g03050
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g03050

 
Sequence (A. th genome BLAST matches underlined)
>02-K015440-022-295-B01-8409
CTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGAGGGA
AACGTTTGAGCACAACCATCACAATACTGATGAATATAGCCATCAATTGAATCTCATGGC
TTTATCTTACTCTCCAAGCTAAACGAACAATACTGAGGGAAACGTCTCAGCTCCTTAACA
TCTACACGCATCTCCTCAATAAAAAACTCAACTTTAGGAACTAAATTGTTATCAACACTA
TAAGTCAACATCGCCGGAGATCTCACAACCATCTTCGCTACTTCTTCTCTTGTAAACCCT
AACCCTTCTTCAAGATACTCAATTTTGGGGATTAGGGTTCGTTCCACATTCGATACAAGC
AACACCGTGTTCCGTGACGTAATCGTGTCGCGACCCACGAATCCTAGATCATGCCCA
GenBank Accession AL946236 [GenBank]
Graphic View Graphic view of gene At2g03050
Predicted Position of Insertion Chr2:900159 - go to primer design
BLAST e Value 1e-151
Hit Clone Code (BAC ID) T17M13
Hit Gene Code At2g03050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial transcription termination factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL946236 [GenBank]


Last Updated on 31.08.2016 09:40