SimpleSearch - Line and FST details


Line specific information

 
Line ID 295B12
Vector Used pAC161
Line Availability only available from NASC (N428248)
Segregation Analysis 100:71:61
Confirmed for Hit At3g45443
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At4g32980 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g32980

 
Sequence (A. th genome BLAST matches underlined)
>90-K015445-022-295-B12-8409
ACTTTGATCCATGTAGATCTTCCCTGTACATGAAGCCTTTACACTTGAATATATCCTGCG
GAATGAAAGTACACTGTTCTTTCACGGAGAAAGAAGATAAATAAGCATTATCTTCTTCTT
CAGTTTTTAACACACATTTTGGAAATTTTGATGTAAAAATTCTCTTTGGAACGTTGTGTT
GTCTGAAATCTTCCCAAAGGTTCTATCAGAAGAAGAAGGATAAAGGCAAGTTTCAACATT
TTTAATGTTCTATGGACATTTGTAGTAATCTAAAGCTTTCTTTTTTACTTATTAGTTCAC
TGTTTATCACAGATAGCTTTGAGATATTATTGGTCTGTGTATCATTGAGCCTATGGGATC
CT
GenBank Accession AL946255 [GenBank]
Graphic View Graphic view of gene At4g32980
Predicted Position of Insertion Chr4:15917375 - go to primer design
BLAST e Value 1e-167
Hit Clone Code (BAC ID) F26P21
Hit Gene Code At4g32980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein ATH1
Insertion Classification TS2TE (5')
Confirmation Status failed

Gene hit At3g45443

 
Sequence (A. th genome BLAST matches underlined)
>54-K118365-0022-295-B12C-35St
TTCGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGACGATTGGGTACCCGG
GGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTATATTCAATTGTAA
ATGGCTTCGGTTTACAATTGATTTGTTTTTTGGTTCAACTCTCGTGTTATTTTATTATTA
CCTTAATTAATCTACCAGTTTACTTTTCATCTAATTATACTAAATCAACAGTCACTTTTC
CCAAAACTGCAAGTCTCTCCTTTTGCCATGTATGCTTAAGTCTAAAATTTTGGTCTTTCA
CATTCGTAAAACAATTCACTGCCTTCTACTATTATTTTTCAATCGCACTTGATGATATCC
TTCACGTAAATCAATCTTAGAGAAGACAACAGACCCTCCCAGTTCATCCATTAGATCTTC
AATAAGAGGAATTGGAAACCTATCTTTCACAGTCATTCCATTGAGTTCCCGATAATCAAC
ACATAAACGCCAAGATCCATCCTTCTTTTTGACTAGCACCACCGGTGAAGCATAAGGACT
AGAACTTACTTGAACTGTACCACTTTGTAACATCTCTTCAACCAACTTGTCAATCTCATT
CTTCTGGTGAATAGAGTACCGATAGGGTCGTTGATTAACGGGATTAGAGCCCTCCAACAA
CTCAATTTTGTGGTCATGTTGAGTCCGAAATGGAGGCAATTCAGTTGGTTCAGCAAAAAT
ATCAGGGAAGTCTTTGACAAGCTCCTCTATCTCCGTATCATCACCCTCCGTCTTTGCTAC
TGCATTCACAGAACAACTCAATCCCTGTTCCAACAACTCTTCTTCTGCTGGCACTTCACG
AACATACAC
GenBank Accession LN713413 [GenBank]
Graphic View Graphic view of gene At3g45443
Predicted Position of Insertion Chr3:16669668 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F9K21
Hit Gene Code At3g45443 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL946254 [GenBank]


Last Updated on 07.07.2016 14:03