SimpleSearch - Line and FST details


Line specific information

 
Line ID 296E07
Vector Used pAC161
Line Availability only available from NASC (N428375)
Segregation Analysis 50:34:29
Confirmed for Hit At4g02890
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g02890

 
Sequence (A. th genome BLAST matches underlined)
>53-K015495-022-296-E07-8409
NTGATCCATGGTAGATTTCCCGGACATTGAAGCCTTTACAATTGAATATATCCTGCGAAG
GAGGCAAATTCAAAGAATCGACGCCTAAATATACAAATCTGTGAAATCTACGAACCCTAG
GAGACTGGTATATCTCCGAACACATACCACTTTAACATGTCTTGAGGCTTGACGGTTTAG
ATACCGAACTAACGGATATGCTATTGTCCTCACATATTTTTGGATGAGGCCTCGTTGGCG
TAAATCTATCCAGATGGGCACATAAGAGCGGTTCCTTCAGACAAACTGCCGATTACTCTT
ATTGGTGATGCGAACATCGCTATTCCCATTCTCTACGCTTGTTTTCAACACCCTATGTAA
ACACTGATAGTGATCGCTGTGTGATCTATATTGATAACTAAACGGAGCCTTATGCTATTA
CCGATAGGATCCTCTAGNNCCGTGATNCATCCATGGCATTATGAATCTCTCTTTCCACAG
CGATACTCGGTTACATTGCTTTGATCCAATGACGTTGTCGACCCTACATCTAGGGAGCCT
ACATAAGCGGAGGATGGNACTCGAGTAAATCTCCGATTATTAGATATTGATGATGCTA
GenBank Accession AL946434 [GenBank]
Graphic View Graphic view of gene At4g02890
Predicted Position of Insertion Chr4:1279755 - go to primer design
BLAST e Value 3e-23
Hit Clone Code (BAC ID) T5J8
Hit Gene Code At4g02890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ubiquitin family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40