SimpleSearch - Line and FST details


Line specific information

 
Line ID 296F08
Vector Used pAC161
Line Availability only available from NASC (N428388)
Segregation Analysis 50:25:16
Confirmed for Hit At3g14210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g14210

 
Sequence (A. th genome BLAST matches underlined)
>62-K015495-022-296-F08-8409
NTTTTGATCCATGTAGAATTTCCTGGACATGAAAGCCTGAAACAAAGAAAAATATTCTGT
TTTTTTGAGCACCACAAAAAAAGGATTTACAAATATTGAAACGCTTTTTATTCGAAACGT
CTAGGCATAATTTGACGTTATAAACCGCAAAATTACGCGAACCACCTCGATGAGACATTA
TAAGACAATAGCTCTCATATATATCGAAATATTCAGCTCAAAGCCATCCAACTAATAATA
GGCGGCGAGGCCCAAGTAAAAGTCACGAGACGGCCGACGACGGATAGCCAAGTTGTTGGG
TTCCCAATACTCACGCATAGTTTCTCCAGTTGGGTAGACGATTAGCTCACGGACCGTCAT
TGGCTGGACCACGTCAGGGTCGGCTCCATATAGAAGATGAGCCATTTCCTCCTGAGCCTT
CTCTGTGTTGTGACGTCCATCGAAGAAGAAGTAAGATCTTTGGTACTCACATAGCTTCGA
GTGCACGTTTCCCTTTCCGCAACCATATGCATTGTGTGTCCCAACACCGCAACACGAAGT
ATTCGTTACGAAGAATCCTGTACAAATATTTTATGATACATTTGTATTAAATAAACAGTT
TGAAAAGAGATATGTACGTATCACTCGAATTTAGTTAATGGAAACAGTTAGTTTTTTTCT
TACTGGAGTTAAGACTTCTTCCTGTCGCAATCCTACGAAGAACGGCGTTGTAGAAATCGA
AGACGGTGAACTGAAACCATAGGG
GenBank Accession AL946452 [GenBank]
Graphic View Graphic view of gene At3g14210
Predicted Position of Insertion Chr3:4731735 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MAG2
Hit Gene Code At3g14210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GDSL-like lipase/acylhydrolase superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03