SimpleSearch - Line and FST details


Line specific information

 
Line ID 297D04
Vector Used pAC161
Line Availability only available from NASC (N428456)
Segregation Analysis 50:32:26
Confirmed for Hit At1g51190
Parent of DUPLO pair 2549
Parent of pair(s) none

Gene hit At1g51190

 
Sequence (A. th genome BLAST matches underlined)
>28-K015553-022-297-D04-8409
TTTTGATCCATGGTAGATTTCCCGGACATTGAAGCCTTTACAATTGAATATATCCTGCGA
TATATATTCAAACGCGGCAGAAGCAGCAGAAGCTTATGACATAGCTGCGATAAAGTTTCG
AGGTCTAAACGCGGTTACAAACTTTGAGATAAATCGGTATGATGTGAAAGCCATCCTGGA
GAGCAACACACTTCCTATAGGAGGTGGTGCGGCTAAACGGCTCAAAGAAGCTCAAGCCCT
ATGGGATCCTCCCATTTAGTTGAGANNNNNANANGCCTNNACTTTTTTAAAACATGTCCG
GGTCAAATAGCAATGATTCTAAGCACTTATTTGTACACTATTTCAGAAACCCATGGACTC
AGTCGTATGGATATGTAAAATACAGGATTTCCAATCCTA
GenBank Accession AL946547 [GenBank]
Graphic View Graphic view of gene At1g51190
Predicted Position of Insertion Chr1:18979559 - go to primer design
BLAST e Value 1e-84
Hit Clone Code (BAC ID) F11M15
Hit Gene Code At1g51190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03