SimpleSearch - Line and FST details


Line specific information

 
Line ID 298A05
Vector Used pAC161
Line Availability only available from NASC (N428517)
Segregation Analysis 50:49:40
Confirmed for Hit At4g02590 At1g75850
Parent of DUPLO pair 2301
Parent of pair(s) none

Gene hit At4g02590

 
Sequence (A. th genome BLAST matches underlined)
>33-K015514-022-298-A05-8409
TTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTTGTAGTTCTTCTCTGTTTAAGAC
GTGCACTGAGGATAGCGAACGCAGCTCAACAAATGGCTATGGGATCCTCCCTATAGTGAG
ANNNNNNNNANCNCTGTGATTCNGCTCTCTATGACACACCAAAATGTGAAAAGACACTAA
ATGCCAAAGAAAACAAAAGCATTTTGGACTTGTTTATTCTTTCCCACATTAAATAACTGA
TCTAATCAGATTGAAATTTGGTTGAAGGGTAGGTAATGGTGGGACCAGAATTAACACCAA
AAATCCATCCAGAGAATTTGAAAGACATGATCTTTAGATCTCTAATCTTATGAACAAACA
GACTAAACATATTGCATAGGGAGTAATACCATAATTCACAAGAAAGAGAGTTCGAGTTTA
AAACTGCAGAAGAGAGAAGAATATACCTTGACTTGGAGCCTGAGAAACTTTACATAATCG
ACAATCTCATCGATCATAGCAGCTCTATCGGTCTGCACACGAAGACGGGAGAAACAGAAA
GTGTCAAACTTTCTATGGGATCCTCCC
GenBank Accession AL946637 [GenBank]
Graphic View Graphic view of gene At4g02590
Predicted Position of Insertion Chr4:1138647 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g02590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g75850

 
Sequence (A. th genome BLAST matches underlined)
>33-K015514-022-298-A05-8409
TTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTTGTAGTTCTTCTCTGTTTAAGAC
GTGCACTGAGGATAGCGAACGCAGCTCAACAAATGGCTATGGGATCCTCCCTATAGTGAG
ANNNNNNNNANCNCTGTGATTCNGCTCTCTATGACACACCAAAATGTGAAAAGACACTAA
ATGCCAAAGAAAACAAAAGCATTTTGGACTTGTTTATTCTTTCCCACATTAAATAACTGA
TCTAATCAGATTGAAATTTGGTTGAAGGGTAGGTAATGGTGGGACCAGAATTAACACCAA
AAATCCATCCAGAGAATTTGAAAGACATGATCTTTAGATCTCTAATCTTATGAACAAACA
GACTAAACATATTGCATAGGGAGTAATACCATAATTCACAAGAAAGAGAGTTCGAGTTTA
AAACTGCAGAAGAGAGAAGAATATACCTTGACTTGGAGCCTGAGAAACTTTACATAATCG
ACAATCTCATCGATCATAGCAGCTCTATCGGTCTGCACACGAAGACGGGAGAAACAGAAA
GTGTCAAACTTTCTATGGGATCCTCCC
GenBank Accession AL946637 [GenBank]
Graphic View Graphic view of gene At1g75850
Predicted Position of Insertion Chr1:28478477 - go to primer design
BLAST e Value 5e-25
Hit Clone Code (BAC ID) T4O12
Hit Gene Code At1g75850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation VPS35 homolog B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g07658

 
Sequence (A. th genome BLAST matches underlined)
>33-K015554-022-298-A05-8409
CTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTTGTAGTTCTTCTCTGTTTAAGAC
GTGCACTGAGGATAGCGAACGCAGCTCAACAAATGGCTAGGGGATGCTCTATTTCAAGAG
CATGGCGCTTAGGAGGGATCCTCACGGACTGAAAAAGATCGTCGTCAGTCTGAAATTGAT
CGAGCGCTCTATGCTTGTTCATTACGACCTCAAGGCATCTTTATATCTGAAGCTAGATGG
ATCTTGGACTACCTCGGATCATAGATACCTCTATGAACTAGGCGACCCGGACATAGAAGA
ATGGGAACGAGAAGGAGTTCTACACCAGCAACTGATATGAGGCGGTTTTATCCTACCACA
CTATATGGGCTCCTATGGAGATCCTACATAANNCGAGTNNAAATGTACCATTGGAAGCCT
ATGGGATCCTCCTATTGGCGAGATNANGCTGGACCCTGTCTCAGAACACGCCAAGCAACC
TATACAGTCTCATATTTGGTACTAACGTTATACTGCTTGTCCCTACCACGAGAGCACCTG
AAAGAGACCCACGGCCCAGCAACATACCCGTTTAAGCATAGTCCCTCGTCTAACGTTCCC
GCACACGAGGAGAGGAACGCCTTTTGAGATCAGGATGTTCTACCGCTTTTCCTA
GenBank Accession AL946638 [GenBank]
Graphic View Graphic view of gene At2g07658
Predicted Position of Insertion Chr2:3478692 - go to primer design
BLAST e Value 3e-35
Hit Clone Code (BAC ID) T5E7
Hit Gene Code At2g07658 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40