Line specific information

Line ID 298F03
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown

Genome hit K18L3

Sequence (A. th genome BLAST matches underlined)
>22-K015554-022-298-F03-8409
TATATAACTATCCTACAATTTCTATTAACATATAGTGTTAATTTTCTGTTGGAGTAATTT
TCTCTTAAGATACTTTAGTTCAAGGATATCCTCCACATAGGTTCATACACGAACTACATT
ACTA
GenBank Accession AL946720 [GenBank]
Graphic View Graphic view of sequence AL946720 of line 298F03
T-DNA Border not detected
BLAST e Value 6e-57
Hit Clone Code (BAC ID) K18L3
Hit Gene Code  
Gene Annotation  
Insertion Classification  
Confirmation Status unknown
Other FSTs Supporting this Hit AL946719