SimpleSearch - Line and FST details


Line specific information

 
Line ID 302A06
Vector Used pAC161
Line Availability only available from NASC (N428902)
Segregation Analysis 50:48:37
Confirmed for Hit At4g11880
Parent of DUPLO pair none
Parent of pair(s) 4514, 4674, 10007, 78977

Gene hit At4g11880

 
Sequence (A. th genome BLAST matches underlined)
>41-K015562-022-302-A06-8409
TTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATTGGCGGGTA
AACCTAAGAGAAAAGAGCGTTTATTAGAATAATCGGATATTTAAAAGGGCGTGAAAAGGT
TTATCCGTTCGTCCATTTGTATGTGCATGCCAACCACAGGGTTCCCCTCGGGAGTGCTTG
GCATTCCGTGCGATAATGACTTCTGTTCAACCACCCAAACGTCGGAAAGCCTGACGACGG
AGCAGCATTCCAAAAAGATCCCTTGGCTCGTCTGGGTCGGCTATGGGATCCTCCCTTNAG
TGAGANCANGNNNATNTCCATATATATACATTTGCTAAAAATATACTTATCCAAAGCGTA
TGCAAAAAGAAATACTATATCAATATCTA
GenBank Accession FR807470 [GenBank]
Graphic View Graphic view of gene At4g11880
Predicted Position of Insertion Chr4:7145759 - go to primer design
BLAST e Value 7e-18
Hit Clone Code (BAC ID) T26M18
Hit Gene Code At4g11880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 14
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR807470 [GenBank]


Last Updated on 31.08.2016 09:40