SimpleSearch - Line and FST details


Line specific information

 
Line ID 302G08
Vector Used pAC161
Line Availability only available from NASC (N428976)
Segregation Analysis 76:53:44
Confirmed for Hit At2g33610
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g33610

Sequence (A. th genome BLAST matches underlined)
>63-K015559-022-302-G08-8409
AATTTGATCACTGATAGCTTTCCTGGACATGAANGCCTTTACAATTGAATATATCCTGAC
ACTCCCTCTCTTTCCGAAACTACGTCTGGAGGCGCCGCAGCAGCTTCTAAGTCGGCTCAA
TTGCCGTCTTCTTCTTCCGATATCGATAATATTCACGTACCTATGGGATCCTCCCTATAG
TGAGAAACCAAATCTTGACTTTGTTATCCAACCAACAGATAACTCGTTCTATTCTACTAT
GGGATCCTCCCTATAGTGAGACTTGGGNNNGAAACAATTGGGTTAAAAATTTGAAATTTT
AAATAAATTTAAAATTAAAATCAAAAAAAACCAATTGGAAACAAAAATTTTGGATTGGTA
AATTTTTGGTTTTAAAAGGCCGGGGTTTTTAATTTAACCCAATTGGGGGACCCCAACAAT
TGAACTGTTTTTTTTTGGAAACCTTGTAAACTNGCCAAGTTGGGTTAAGAAAAAATGGGA
GGGGGCCTTCAAACCCCCAAAAAAACGGGGGGGGATAATGTTTGGGGGCCGAATTCCTTA
TTGGCCATTTTCGTTGGGAGAAAAATGGTTGCTTTTACCCCCTGATTTTTTGAAAAAGTT
CTTGGACCTTTCCTAAAATCCTCGGTGCCTATGGGAATCCCCCTATCGAGGGGGAAATAA
GGGGATGAAAGGACCCACCCACAATATCATA
GenBank Accession BX890957 [GenBank]
Graphic View Graphic view of gene At2g33610
Predicted Position of Insertion Chr2:14229072 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) F4P9
Hit Gene Code At2g33610 [TAIR] [MIPS] [SIGnAL]
Gene Annotation switch subunit 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Sarnowski et al. 2005, atswi3b-2]


Last Updated on 14.10.2014 10:23