SimpleSearch - Line and FST details


Line specific information

 
Line ID 302G09
Vector Used pAC161
Line Availability only available from NASC (N428977)
Segregation Analysis 100:89:70
Confirmed for Hit At1g76420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g76420

 
Sequence (A. th genome BLAST matches underlined)
>71-K015559-022-302-G09-8409
NTTTTGATCCATGTAGCATTTCCCGGACATGGAAGCCTTTACAATTGAATATATCGATGC
TTCGGTTTGACTACTAATAACTGTGTTTTTTTGGTTGGCGCCAAAAAAGTGTAATAGAAG
ATTCAAATGGAATACTTTGTACTTAGAAACCTTTTTAACTTTCACATTTTAACTTCTACA
AAGAGTACTACGGGGATCCTCGCATCTAGTGAGGGTTCCCAATGTGCGGGTTCCGGTTCC
CAATGTACGGTTTTGGGTTCCCGATGTACGTGCTATCCACAGGAGAGAGACCTTTCCGAC
CTTCGTTCCCCTGCTATGGGACCCTCCCTATCTGCTGAGGCGNGCGTCTCACTCTCACTC
GTGCATCTCTGTCTTTAAAAAAATTTGTATTTTTTCTCTTGTCAATTTATGAGTTGACTG
TTTGAAACCAAAAATTTTATACTACTATGGGATCCTCCC
GenBank Accession AL947248 [GenBank]
Graphic View Graphic view of gene At1g76420
Predicted Position of Insertion Chr1:28673478 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) F15M4
Hit Gene Code At1g76420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC (No Apical Meristem) domain transcriptional regulator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit F28K19

 
Sequence (A. th genome BLAST matches underlined)
>71-K015559-022-302-G09-8409
NTTTTGATCCATGTAGCATTTCCCGGACATGGAAGCCTTTACAATTGAATATATCGATGC
TTCGGTTTGACTACTAATAACTGTGTTTTTTTGGTTGGCGCCAAAAAAGTGTAATAGAAG
ATTCAAATGGAATACTTTGTACTTAGAAACCTTTTTAACTTTCACATTTTAACTTCTACA
AAGAGTACTACGGGGATCCTCGCATCTAGTGAGGGTTCCCAATGTGCGGGTTCCGGTTCC
CAATGTACGGTTTTGGGTTCCCGATGTACGTGCTATCCACAGGAGAGAGACCTTTCCGAC
CTTCGTTCCCCTGCTATGGGACCCTCCCTATCTGCTGAGGCGNGCGTCTCACTCTCACTC
GTGCATCTCTGTCTTTAAAAAAATTTGTATTTTTTCTCTTGTCAATTTATGAGTTGACTG
TTTGAAACCAAAAATTTTATACTACTATGGGATCCTCCC
GenBank Accession AL947248 [GenBank]
Graphic View Graphic view of sequence AL947248 of line 302G09
Predicted Position of Insertion Chr1:29276941 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) F28K19
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40