SimpleSearch - Line and FST details


Line specific information

 
Line ID 302H04
Vector Used pAC161
Line Availability only available from NASC (N428984)
Segregation Analysis 50:47:32
Confirmed for Hit At1g54960
Parent of DUPLO pair none
Parent of pair(s) 2887
Note Although the line exists, the insertion in At1g68550 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g54960

 
Sequence (A. th genome BLAST matches underlined)
>32-K015562-022-302-H04-8409
AAATTTGATCCATGTAGCTTTCCTGGTACATGAAGCCTTTACATCTAATTGTGCATCCAA
GGAGAAAACTCAGGTTCATAATCAAGCCTATTTGTTTCTTGCTGATCTTGTGCTACATTT
TTTTTACATTACATGACTGTCTTATTTAGGAGAACAGAAGGCTCATATTTAGGAGCTTGA
AGAGGAAGAGAAGCTACTCAAGAATCGCTCTCATCCAAATATAGGGGACAGCTATAACGT
TATCGATTCGTTGCAAGGCTGATTGATCCAGTGTGTTAGCGCTGTCTTTTTAATAACTTT
TGCATTCTTTGTTTGGCCTTAGAGATAGTTTGAGTCGGTGAGAGCAAGATGAATCTTTGA
ATATCTTGCTTGAATTTGGACCTGGCGGAGCTATATGTTCACTCTTGAAGAAATCGGGAG
CCTTTCCTGAATCTGAAGGCCGCTCTGCCGAAAAACTATTGGACACCCTGAATTGGAGAT
GATGGTAGCATTTTTACACTGTGTGCATAAGGATGTTAAGCAATACACGAACCAACTGCT
TGAGGGATAGGAGACCCTGCATAATCATGGCATCATGCACTGCGGCAATAAGGGACCTAT
TGTGGAATGTTAGCGTTGACTAAATGCGAGATGCGTGCCCTGCTTATATGACGTCTCAAA
TTCCTCACTTCTTGGGGTGGCTATATCCCTTGCGGAATTACAAGGAGGCCTTAAACTTGC
TGATTTGGGGCCGTCCAAACAGG
GenBank Accession FR807492 [GenBank]
Graphic View Graphic view of gene At1g54960
Predicted Position of Insertion Chr1:20500451 - go to primer design
BLAST e Value 1e-124
Hit Clone Code (BAC ID) F14C21
Hit Gene Code At1g54960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NPK1-related protein kinase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g68550

 
Sequence (A. th genome BLAST matches underlined)
>32-K015559-022-302-H04-8409
AATTCTGATCCATGTAGCATTTCCTCGGACATGAAGCCTTTACAATTGAATATATCCTGA
TGACGTCTCGACCGTTGCTCCAACTGCTCCAACTCAAATGTTCCTGCTGGTGGAAACAAG
GAAACGTTGTTCGATTTCGACTTTACTAATCTACAGATCCCTGATTTTGGTTTCTTGGCA
GAGGAGCAACAAGACCTATGGGATCCTCCCTATAGTGAGTAAGTGGAGATCTCACATGTA
TCCGCTTGCTTTGAAGGCTGGGGGGGAACGTGTGCTTTTTCCACGATGCTCCTCACGGGT
GGGGGTCCATCTTGGGGACCACTGTCGGCGGAGGCAGCTTGAGCGAAGGACTTTTCTTTA
TTGCAGTGATGGCATTGTGCATGAGCGCACCTTCCTTTTCCACTATCGTAGCAATAAGGA
GACAGACATGTGGGCAATAGGAATCCGAGGAGGTTAACGGATGTGACCCTTGGATGAAAA
GTGTCAGTAGCCCTATGGAATTGTGAGAATAAAGATGTTCGAACATACGCGAACCAACTG
CGTTTGGGGATCGGAGCACCTGAATAATCATGCCATCATGCCCTGCGACGTTAAAGAGCC
TATTGTGGAATGTTAGCCTAGTAAATACTGCGAATTGGGGACCTGCTAATATGAGGATCT
TTATTGCGCACTAATTGAGGGAGCTCATATGCTTGCGGATAATCAAGGATGGCTTACCTC
GCTGGATTTGCGGCGCCCAAACAGGAGCGGAGCGGCAAATCAAATTTTAAGTCTCAACTT
CTACTAAAGTAAAACA
GenBank Accession CT026245 [GenBank]
Graphic View Graphic view of gene At1g68550
Predicted Position of Insertion Chr1:25726166 - go to primer design
BLAST e Value 5e-71
Hit Clone Code (BAC ID) T26J14
Hit Gene Code At1g68550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 07.07.2016 14:03