SimpleSearch - Line and FST details


Line specific information

 
Line ID 303F06
Vector Used pAC161
Line Availability only available from NASC (N429058)
Segregation Analysis 50:10:3
Confirmed for Hit At4g37260
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g37260

 
Sequence (A. th genome BLAST matches underlined)
>46-K015560-022-303-F06-8409
CTGATCCATGTAGATTNTCCCGGACAGTGAAGCACTTTACAATTGAAAAGCTTTTGGGTT
GAAGAGGATACTAGCGAGTAAGAGAGATGTTTTATACGAGAGGGGAGTGGGCAAAAGGGT
CACCGGTTCAACCGGTAATATTTTTCTTGTCGATTTAGCGGAAACTGACTATTAAACTAG
GGGATCCTCCCGTTAGTGAGAGGGGCAATATCGCAGCTTTTGGGATCTCAGCTATAGTTA
GTGGATTAAGCGTAAACGCACTCAATGTACC
GenBank Accession AL947350 [GenBank]
Graphic View Graphic view of gene At4g37260
Predicted Position of Insertion Chr4:17540505 - go to primer design
BLAST e Value 7e-24
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g37260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 73
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g58790

 
Sequence (A. th genome BLAST matches underlined)
>46-K015563-022-303-F06-8409
CTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGCAAAT
ATTTTACTCCTGTAGACAGTCACACCGACACATTAGCAGGGGGAGGGTTCCAGTGTGGGA
GCCCACATGGAGAATTAATGGTGCGTTATTCCTGGAGATCACCGTCCATTAATTGCTCTC
TTATGGCTATGGAGTTGGTAGTTAACCAAGTTTTTGGGATTTTAACTATAATTAATCAAT
TAATCTTAGTAGCAATCAATGTACCACTTCCACAAACTTATTGGTCTCAAGTCTTTCTCT
GTAACTTATAGCGTGTCCTCGTCGTCATTATAATAGTTTGTAGTTGTACTCTACTTTTTT
GGAAGATATTATTCTTCAGCTATGGGATCCTCCCTTAGGTGAGANNNNNNNNNNNNNNNN
NNNCCCNNNNNNNNNNNANNNNNNNNCNNCNNNNNGCCCCCCCCCCNNNNNACCCGCCCN
CCCGGGCGGCGGGCGCCGCGGCGCCGCCGCCCGNGCCCCGGCCGCCCCCGCCCCGCCCGC
GANGAAACACCGCACCGACGACACGAAAAGACAGAACAACACCCAAACACA
GenBank Accession AL947351 [GenBank]
Graphic View Graphic view of gene At3g58790
Predicted Position of Insertion Chr3:21746587 - go to primer design
BLAST e Value 8e-172
Hit Clone Code (BAC ID) T20N10
Hit Gene Code At3g58790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation galacturonosyltransferase 15
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 31.08.2016 09:40