SimpleSearch - Line and FST details


Line specific information

 
Line ID 304H04
Vector Used pAC161
Line Availability only available from NASC (N429176)
Segregation Analysis 50:49:39
Confirmed for Hit At5g14340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g14340

 
Sequence (A. th genome BLAST matches underlined)
>32-K015592-022-304-H04-8409
AATTTGGATCCATGTAGCATNTCCTCGGACATGAAGCACTTACAATTGAATATATCCTGG
CTGCGGCGCCTAAGGGATCCTCCCTATAGATATTGAAGTGCGTTGAAGATGGGACTTGGG
TGCAATGTGGTAGTTGTGAGTGCTGACTGGAACTGTCATTGGGAAACCGTCTATCTTAGA
CAGGATGCTCGTAGATGTATTGATGACACTAGTGGGATACTACCTACAGTGAGACGAAAA
CCGTGCTGTGACAAAATTGGATTGAAGAGAGGTCCATGGACTATAGAAGAAGATCATAGA
CTCATGAACTTCATTCTTAACAATGGCATCCACTGCTGGAGAATTGTCCCCAAACTCGCA
GGTACTTTATTATTAATACATGCATGCATTATTAGGTTTCCTTTATATTCGTTTTTTTTC
TTGGGGAGTTAAACGTTTACGTGTACATGAAGGTTTGTTGAGATGCGGGAAGAGCTGTAG
ATTGAGATGGATCAATTATTTGAGACCCGATCTCAAGAGAGGTGGTTTCACTGATGCTGA
AGAAGATCGGATTATGGAACTTCACTCTCAACTTGGCAACCGGTACGATAATCTGAAAAA
TAAAACTTATCCATATATTTTCATTAGCCGGCGTCAAACTATGGGATCCT
GenBank Accession AL947501 [GenBank]
Graphic View Graphic view of gene At5g14340
Predicted Position of Insertion Chr5:4623197 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F18O22
Hit Gene Code At5g14340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation long noncoding RNA
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T7N9

 
Sequence (A. th genome BLAST matches underlined)
>32-K015570-022-304-H04-8409
AATTTTGATCCATGTAGCATTTCCTCGGACATGAAGCACTTACAATTGAATATCTCATCA
GTGTAAGCCATTATTACATCAATCAAGATCATGTAAATAGTAAACAATGAAGGCCCAGCT
AATTAAGGTGGCATGGGTATATATTAAACACTTTTGTTTCTATTACGACATGTAATTAAC
TTCAAATCAATTGCCTCCATCAATGCTATGGGATCCTCCCTTTAGTGAGATGGGAGGCAC
CATCAAAAGACGCATGGAGGGTATTTCCCAACATGCTACAAACGTCGACGTCTTGACAAT
AACTGTATTGTTCATGATAATGATATTTTGCTTTCAAACATAATCTCAGTCTAATCTTTT
TTTTTTAATCAAGTTTGCATGACTCCTAAAATTAACCCCCCATAAGGAAAAAAGTTCTCT
TAATTGGAAGGGATCTTAAGCTTAAAGATAAAAGGATGTATCCAAATTAGCTATGGAATC
CTCCCTTAGGTGGAGANGAGACCCGATCTCAAGAGAGGTGGTTTCACTGATGCTGAAGAA
GATCGGATTATGGAACTTGACTCTCAACTTGGCAACCGGTACGATAATCTGAAAAATAAA
ACTTATCCATATATTTTCATTAGCCGGCGTCAA
GenBank Accession AL947500 [GenBank]
Graphic View Graphic view of sequence AL947500 of line 304H04
Predicted Position of Insertion Chr1:9460330 - go to primer design
BLAST e Value 2e-73
Hit Clone Code (BAC ID) T7N9
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03