SimpleSearch - Line and FST details


Line specific information

 
Line ID 305A06
Vector Used pAC161
Line Availability only available from NASC (N429190)
Segregation Analysis 50:45:43
Confirmed for Hit At2g22630
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g53240

 
Sequence (A. th genome BLAST matches underlined)
>41-K015593-022-305-A06-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATTTGGTATAT
GCTATCGAGTGTCTCGCCCAGCTTCTTGAGTCTTCACCACATAATATGTAATAAAAAGCA
TTTTGCATTCTTTCGATAGCTTCAGATTCGTCAGCTCAGCTCTTTCCTCTCCAGAAGATA
CCCTGATGGGATCCTCCCTAGTAGTGAGAATGAAAAGGGTAATATATGAATGCCCTATGG
GATCCTCCCTATAGTGAGAGCANCATTCCAAAAAGATCCCTTGGCTCGTCTGGGTCGACT
ATGGGATCCTCCCTATAGTGAGAT
GenBank Accession BX890958 [GenBank]
Graphic View Graphic view of gene At1g53240
Predicted Position of Insertion Chr1:19856942 - go to primer design
BLAST e Value 2e-36
Hit Clone Code (BAC ID) F12M16
Hit Gene Code At1g53240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Lactate/malate dehydrogenase family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At2g22630

 
Sequence (A. th genome BLAST matches underlined)
>41-K015571-022-305-A06-8409
NTCTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGACTCGACTCTTTTG
ATAAATGAGCCGGTCCGACATGTATATATCACTGGCCTAGTTTTCAACATATACATATTT
TTCTTACCCTTAGAACGCATAATTGAGTTGGTTGCTCTATGCGGACGAACACGCTAACGA
TGTAACATTTTAGAAATCATACGCGTATGGGAGTCCTACCATGGAGTGAGGTCTGACTGC
CCTACGGGATACTGCCTGTCGTGAGAGCAGCATTCCAAAAAGATCCCTTGGCTCGTCTGG
GTCGGCTATGGGATCCTCCCTTNAGTGA
GenBank Accession FR807539 [GenBank]
Graphic View Graphic view of gene At2g22630
Predicted Position of Insertion Chr2:9620667 - go to primer design
BLAST e Value 4e-10
Hit Clone Code (BAC ID) T9I22
Hit Gene Code At2g22630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 17
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40