SimpleSearch - Line and FST details


Line specific information

 
Line ID 305F05
Vector Used pAC161
Line Availability only available from NASC (N429249)
Segregation Analysis 59:11:4
Confirmed for Hit At3g13670
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g13670

 
Sequence (A. th genome BLAST matches underlined)
>38-K015571-022-305-F05-8409
NTGATCCATGTAGAATTTCCCGGACCATGAAGCCTTTACAATTGAATATATCCTGTCTTC
TTTTCTCTCTCCATTTTGGGAACTTTCATCCATAAACTTCTATTTTTCTCATCGCAAACT
TGAACCGTCGTAACCCTAAATCGCCATCTTCATCAGTCGGCAAATCGAATCTCCGATTAT
ATATCAAATAGCTTACCAAATCCGACATGACCCAGGCCCTCGTTTTCGGAGGACTATAAT
GATCGGACTCTTCGTGTCCCGTCTCGATTGCATGGGGTTTGAGCTATGCCGGAGCTTCGC
CGTGGAGTCCGCCGTGGCCGTGTTACTGATGCTGTAGCTCCCAATCAGCTTCCGCAAACA
CCTACAGAAAAGAAACCGAAGAAGAGTACCGTTAAAGCTCCAAAACCGGTTGCCGGCGGA
GTTACAGGAGTTGCAGAGAGGCCGAGGGCTATGGGATCCTC
GenBank Accession BX942943 [GenBank]
Graphic View Graphic view of gene At3g13670
Predicted Position of Insertion Chr3:4469201 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MMM17
Hit Gene Code At3g13670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03