SimpleSearch - Line and FST details


Line specific information

 
Line ID 305G09
Vector Used pAC161
Line Availability only available from NASC (N429265)
Segregation Analysis 50:29:21
Confirmed for Hit At3g21520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g21520

 
Sequence (A. th genome BLAST matches underlined)
>71-K015593-022-305-G09-8409
TTTGATCCATGTAGATTTCCCGGACATGAATGCCTTTACAATTGAATATATCAAAGTCCT
GACAAGTGTCTTCTGTGTTTCCCTGAACCGAGGATAAAAGCAGCTCGCGGTATTAGCGTC
AAGCAGCACCAGTGTACCAAACACAGCCAGCACGAAACCCGCATGAACGAAATCCGCTAT
CCTAAGCTTGTACTTGGATAAATCCACGGATCCTGGCTCCGCGTAAGTCCAAAGACCTTT
CTTGGTGACTATACCGAACTTTCTTGATCCGTCAACGCCTTTGAAACTATCGGTAAAGCA
TGAGAAGACGCAGGAAAAGCTGCAAAGGGCGACAAGAATGCTCGACATGACCTTATTACC
TGTGGAGCATTCACCGTCGTTAGTGAGGACAGGGTTAAGTAGAAGGTAGATAAAGAGTGT
TCCCGTTGGGAGAAGCTTTATAAGACTCACTATGGGATCCT
GenBank Accession AL947610 [GenBank]
Graphic View Graphic view of gene At3g21520
Predicted Position of Insertion Chr3:7582481 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MIL23
Hit Gene Code At3g21520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation DUF679 domain membrane protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23