SimpleSearch - Line and FST details


Line specific information

 
Line ID 305G09
Vector Used pAC161
Line Availability only available from NASC (N429265)
Segregation Analysis 50:29:21
Confirmed for Hit At3g21520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g21520

 
Sequence (A. th genome BLAST matches underlined)
>71-K015571-022-305-G09-8409
NTTTTTGATCCATGTAGATTTCCCTGGACATGAAGCCTTTACAATTGAATATATCAAAGC
CATGACAAGTGTCTTCTGTGTTTCCCTGAACCGAGGATAAAAGCAGCTCGCGGTATTAGC
GTCAAGCAGCACCAGTGTACCAAACACAGCCAGCACGAAACCCGCATGAACGAAATCCGC
TATCCTAAGCTTGTACTTGGATAAATCCACGGATCCTGGCTCCGCGTAAGTCCAAAGACC
TTTCTTGGTGACTATACCGAACTTTCTTGATCCGTCAACGCCTTTGAAACTATCGGTAAA
GCATGAGAAGACGCAGGAAAAGCTGCAAAGGGCGACAAGAATGCTCGACATGACCTTATT
ACCTGTGGAGCATTCACCGTCGTTAGTGAGGACAGGGTTAAGTAGAAGGTAGATAAAGAG
TGTTCCCGTTGGGAGAAGCTTTATAAGACTCTCTATGGGATCCT
GenBank Accession AL947609 [GenBank]
Graphic View Graphic view of gene At3g21520
Predicted Position of Insertion Chr3:7582488 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MIL23
Hit Gene Code At3g21520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein, putative (DUF679 domain membrane protein 1)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL947609 [GenBank]


Last Updated on 31.08.2016 09:40