SimpleSearch - Line and FST details


Line specific information

 
Line ID 306H12
Vector Used pAC161
Line Availability only available from NASC (N429376)
Segregation Analysis 50:22:17
Confirmed for Hit F15O5
Parent of DUPLO pair none
Parent of pair(s) 3750, 9809, 64861, 95388, 95389

Gene hit F15O5

 
Sequence (A. th genome BLAST matches underlined)
>96-K015575-022-306-H12-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTAAGACTAAGTCGATCAC
ATAATATGGATATATGGTTAGAAAAATACAGAAAACTGCTATTGCTTAACAAACCTTGTG
TTGTTATTATAAGCGGAACAACTAACAATTCACTAGATAAACCTTGACGTAAGGGAACTA
AAACACTTGACTCAGAGTAGTAACACAAATTGACCCTATACATATATAGAAGTAGGTTAC
TTTCTCTTATTGATATTTGTTTCATAGTTTCAAAATATTTTGGTATACATTATTTCTAAT
CCCTATTTGTTATACTCTTGATCTCTCTCCAGCATGGCCAAGATCATCAGTCGTTTTAAA
ATACAACAAGCTGATGATCCTGAAACCTTGGTAAGTTCTTCTTAGAACCTTGCAATCTAT
GGGATCCTC
GenBank Accession AL947765 [GenBank]
Graphic View Graphic view of sequence AL947765 of line 306H12
Predicted Position of Insertion Chr5:25999986 - go to primer design
BLAST e Value 1e-167
Hit Clone Code (BAC ID) F15O5
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL947765 [GenBank]


Last Updated on 31.08.2016 09:40