Line specific information

Line ID 307H02
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown

Genome hit K1F13

Sequence (A. th genome BLAST matches underlined)
>16-K015597-022-307-H02-8409
CTAAGAAGCTTGAAACCAAATGTCCGAAGGATGTAGGGATTCTAGGGGATGCTTCCT
GenBank Accession AL947858 [GenBank]
Graphic View Graphic view of sequence AL947858 of line 307H02
T-DNA Border 40 base(s) before start of sequence
BLAST e Value 3e-16
Hit Clone Code (BAC ID) K1F13
Hit Gene Code  
Gene Annotation  
Insertion Classification  
Confirmation Status unknown