SimpleSearch - Line and FST details


Line specific information

 
Line ID 308E07
Vector Used pAC161
Line Availability only available from NASC (N429527)
Segregation Analysis 100:100:100
Confirmed for Hit At5g63110
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g55850

 
Sequence (A. th genome BLAST matches underlined)
>53-K015783-022-308-E07-8409
GAGCATTTACATTGATATATCCTGCATGCATGTCGACTCTATGGGATCCTACTTATAGTG
AGAGATATGCGATATTCGGTACATCGAGTGTGTGTGATCCTGATAACATATGAGACTGGC
ATTGTCCACAACCTGTCCGATAAAATAGCCATAGGATCCTCACTACATTGAGCTTAAGGC
CCAATAACTAACACACGGAGTTTTGAGTCATTAAGATTTCAGGCTATGACATCCTACTTA
TAAAAAGTCAACTATGAAATGCATGCTAGAATAAGATATTGGCTATGGGATCCTCCCTAT
AGTGAGACAAACGCTGGAGCCACCATCCTCTTCCATCTATCTTCATACTCA
GenBank Accession AL947941 [GenBank]
Graphic View Graphic view of gene At3g55850
Predicted Position of Insertion Chr3:20725578 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) F27K19
Hit Gene Code At3g55850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Amidohydrolase family
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At5g63110

 
Sequence (A. th genome BLAST matches underlined)
>53-K015815-022-308-E07-8409
ATTTCCTGGACATGAGCATTTTCAGGTTTAACTCGATCCTTGGCTTTTGACACACATGCC
TATGTGATCGTCCCTATAGTGAGANGTGAGAGACGGAGATGGAGGCAGACGAAAGCGGCA
TCTCTCTGCCGTCGGGACCCGACGGACGTAAGCGGCGAGTCAGTTACTTCTACGAGCCGA
CGATCGGAGACTACTACTACGGTCAAGGCCACCCGATGAAGCCTCACCGGATCCGTATGG
CTCATAGCCTAATCATTCACTATCACCTCCACCGTCGCTTAGAAATCAGTCGCCCTATGG
GATCCTCCCNTATAGTGAG
GenBank Accession BX890962 [GenBank]
Graphic View Graphic view of gene At5g63110
Predicted Position of Insertion Chr5:25318277 - go to primer design
BLAST e Value 2e-116
Hit Clone Code (BAC ID) MDC12
Hit Gene Code At5g63110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone deacetylase 6
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40