SimpleSearch - Line and FST details


Line specific information

 
Line ID 308H02
Vector Used pAC161
Line Availability only available from NASC (N429558)
Segregation Analysis 50:48:39
Confirmed for Hit At1g74030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g74030

 
Sequence (A. th genome BLAST matches underlined)
>16-K015815-022-308-H02-8409
GAGCATTTACAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTATGG
GATCGTCCCTATAGTGAGAAGGCGATGAAAACTAAGGAGTCAAAAGAACCATACTTAAAC
CGGTTCATTTTCCAATTGGTTGACTGTTAAAGAGAAGTTTCTGGTTTTGGTTTGGTTCGG
TTCGGTTCGGAACAATTCAAATAAATAAAACAAATCAAAAATATTCACTATGGGATCCTC
CCTATAGTGAG
GenBank Accession AL947987 [GenBank]
Graphic View Graphic view of gene At1g74030
Predicted Position of Insertion Chr1:27841973 - go to primer design
BLAST e Value 6e-80
Hit Clone Code (BAC ID) F2P9
Hit Gene Code At1g74030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation enolase 1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g18760

 
Sequence (A. th genome BLAST matches underlined)
>16-K015783-022-308-H02-8409
TATCATGAAATTTCCCGGACATGAAGCCATTTACAATTTCGCAGTCACGACGCCAGTAGA
CCTGAGGGTTAGATCATCGCCTCATTCCAGCAAGGCGTTGCCCGTTCACGCAATGAATAC
TCTCGGCACAGACCACCTGACTCTAAGCACGGGAACAGGGTGGCAGGTCGAACTGACTGT
TATAGACAAGCATCATTATCTAATCAAAGATACTGCCGACCCTGTTCATATGGAGTAAAA
TTGGACAACATCACCTGTGCTCTGGGATCCTCCCCTCTCCTAGAGAGAGCAAACCCCTAT
CGAGAGGCTACACAAACAAGGAACACTCTCTTCAGAGAGATTTTCATCATACCAACGGAA
CCCCCCATAGCTAGGGACCTCTCGACAGTAGATAACCTTGTCAGGTATCTACCTACCATA
TTTGTTCTCCCTTCGCAAAATATACTACTCGTGGAAAAGATCTCTTGCTGCATCTATGTC
CTCCACCCTATAGGGAGAATTATGATGAGAAGCTCTTCAATTCAGCCGCCCAGAAATTGT
GGTCACGCGAAAGATTCTTCTACTGGTACATCTTCAACCTCTTCTTCATCGCAGGAATTC
GenBank Accession FR807619 [GenBank]
Graphic View Graphic view of gene At5g18760
Predicted Position of Insertion Chr5:6260831 - go to primer design
BLAST e Value 2e-12
Hit Clone Code (BAC ID) T1A4
Hit Gene Code At5g18760 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 14.10.2014 10:23