SimpleSearch - Line and FST details


Line specific information

 
Line ID 309A01
Vector Used pAC161
Line Availability only available from NASC (N429569)
Segregation Analysis 76:74:65
Confirmed for Hit At1g03740
Parent of DUPLO pair 12547
Parent of pair(s) none

Gene hit At1g03740

 
Sequence (A. th genome BLAST matches underlined)
>01-K015816-022-309-A01-8409
GATCTGTNATTTCCCGGACTGAAGCCTTTAAATTGAATATATCCTGTTGAAGATGGTAAC
TTCTGTTTTCTCCAGTAATTGTCTGTTGGGGAACCGCAAAGCTTGAAGATTTTATGCTAT
TGTTCTACCTATGGGATCCTCGCCTATACTGAGAATCGTGCCCTTGAGAGTGAGGTAACT
GGTTCATGATGTTTTACTATGTTCTTGGTTTACTGACATCATGGAAGCATTAGTGACAAA
ACTCTGTTCTTTTGTCAGCACTTCAAAACCAAGCCGTTTGCTTGCGATCCATCGAACTTA
CCAAAATATCCTCCTATGGGATCCTCCGCTATAGTGAGATGTCTAGCGCGCCCCTCCCTC
CCACTACCCCCCCCACCCATCACATTTCTTAAAACATCCCCGCGCAACCGCTTCTCCTAT
CACAGAACCTCATACCTCACCAACCCCCCCGTCCCCACCCACCCCTCCCCATACTCCCCT
CTTCCCCCTACATTACCTCCCGTCTTATTTTTCCCCCCTCTCCCCTGTTTTCCCCTTTAA
CCACCCCTCCAACCAATTTCCCCATTTCTCCACCCTTTTCAACCCTCCTCCCCGTGCCTA
CCCTCCGTGTTATCTGCTCCACCCATACTTGCTGATGGCCCCTATAGCCGCCCCGAAGCG
CCTATATCCCGCTACCCTTATCATATACCTCACATTAATCTATTACCCTTCACGGCTACT
AACTACACCCACACTCGTTCTTAATCCCTCCACCTTCGCCCACATGCCCACATATCCCCC
CCCCGACGCAGATAAATAACACTACGTTCTAGAAGACGCACCATCTTGCCGCGGCCGCCG
CGCTCTTCATCTTACTTTTCATTCCAGTCCCAGCGCCGACCGCTCGAGGCGTAATCCACT
ACCACAACAACCGTCTTCCA
GenBank Accession BX942948 [GenBank]
Graphic View Graphic view of gene At1g03740
Predicted Position of Insertion Chr1:935682 - go to primer design
BLAST e Value 1e-81
Hit Clone Code (BAC ID) F21B7
Hit Gene Code At1g03740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942947 [GenBank]


Last Updated on 14.10.2014 10:23