SimpleSearch - Line and FST details


Line specific information

 
Line ID 309B03
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g01290

 
Sequence (A. th genome BLAST matches underlined)
>18-K015816-022-309-B03-8409
GATTAGAGGAGACAAGAAAGCAAAAGCTACAAGAAAGATGAAAAAAAGAGACTTNGGCCA
GTAGAGACAGCCTATGGGATCTNTCTTATAGTGAG
GenBank Accession AL948017 [GenBank]
Graphic View Graphic view of gene At1g01290
Predicted Position of Insertion Chr1:115882 - go to primer design
BLAST e Value 2e-15
Hit Clone Code (BAC ID) F6F3
Hit Gene Code At1g01290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cofactor of nitrate reductase and xanthine dehydrogenase 3
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 10.06.2021 13:37