SimpleSearch - Line and FST details


Line specific information

 
Line ID 309E09
Vector Used pAC161
Line Availability only available from NASC (N429625)
Segregation Analysis 64:47:42
Confirmed for Hit At1g66410
Parent of DUPLO pair none
Parent of pair(s) 6399, 6400, 6402, 6404, 6405, 7812, 7815, 83145, 83268, 83276

Gene hit At1g66410

Sequence (A. th genome BLAST matches underlined)
>69-K015784-022-309-E09-8409
TGATCTGTAGATCCCNGGACATGAGCATTTACAATTGATATATCCTGTAGCAGAGTCTAT
GGGATCCTGCCTATAGTGAGATCTACTAAACTCAGTATTATCAGAGGACTTAAACCTGTA
GCTACATACCACCTTACAAGTAGATTCGCATACCAAAGTCTGATTGATATACATACTAAA
CATGAATGAAACCAGGTCTTTTGTTTAAACGTTTTTGAGCAAAAAAAAGCCACTAATCAA
CCAAAAACATGACCATTAAATGAGTCTCATAAAAACACTATATGATCCTCTCCATGATGT
GACGAAACTCTTAGACATAACCAAGATCTTATCTTTCATAATAAGAGCGTCGGGGCTAGG
GGATCCTCACTATAGTGTGACATGAGATCCTAGGGACAGATAGATAGCCGATGAAAGCCA
TCCAAGGAGGTCGATATGACCCTTCCTTTGAAGAACTCACTTAGGCTTTCGGCGGCCGGG
ACTGAATGTTTCATATATATGAACGAAA
GenBank Accession AL948072 [GenBank]
Graphic View Graphic view of gene At1g66410
Predicted Position of Insertion Chr1:24775000 - go to primer design
BLAST e Value 1e-71
Hit Clone Code (BAC ID) T27F4
Hit Gene Code At1g66410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calmodulin 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Zhang et al. 2009, cam4-1]
Other FSTs Supporting this Hit AL948073 [GenBank] AL948072 [GenBank]


Last Updated on 31.08.2016 09:40