SimpleSearch - Line and FST details


Line specific information

 
Line ID 311A11
Vector Used pAC161
Line Availability only available from NASC (N429771)
Segregation Analysis 100:92:72
Confirmed for Hit At1g12120
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At1g71680 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g71680

 
Sequence (A. th genome BLAST matches underlined)
>81-K015792-022-311-A11-8409
TGTCATGTAGATTTCCCGGACATGAGCATTTACAATTGTAGGTATTCTTCACAACACGCA
TAACCCATCCAATGCCCTCCTCACACCATAGCTGCCCTATGCTATACTCCCTATATCGAG
ATGGCAAATGGTACAGTTGCACGAAGCCGTTCCAGGGAAACGGATGGACCGTTACCCCGA
GCTATGGGATCCTCNCTATAGCGAGACTAAGAGCTCCGCCCTAGTCGCCAGATATCATCG
CTCTCTCTCTCGCGACGACAGATTCAGAATGTGTCATCACTATAGGAGCCTCGCGGTAGC
GATACAAGAGCCTATGGGATCCTCGCCTATATGCAGATGAACAATTGCCCTTTGGGTACA
GACGGTGTGTGCACCTCTCTTCTTGAGATATGTATCTTTTCTTTCTACAGGCCACGCTAC
CCAGGTGGGCTCGGAAATCTAACCAAAGGAATGTTTTCAGGCTGCCAATATATCGCAAAG
CTGGTGACTTCCCTTAATTCCCGGCTTAGCATTTCTCAAATTGGTTAGTCCTCTAAAGGG
GTCCTTTTAATTAAAAGGCCCAGCCCAACCTTGGTTTTTATGTCCGCAAGGAAAAAGACG
CTTTTGACTTCCTCCACCTAGCAAACCACCGGTTGAAATACAGGACCTTTGGAAACGCGT
CCAAATATTTAGCCCCCACAAGGGAAAAGTATGTGGCCGACTGGTTATTTTTTGCGGGAA
ACCCTCTTTAAGAAAAACCTTGGCGACCTGCCCACATTTTAAAGGGCTTTTTTATAGGCC
CAAAGCCTAAGAAATTTTTGGGTTTGGGAATTTTAC
GenBank Accession AL948264 [GenBank]
Graphic View Graphic view of gene At1g71680
Predicted Position of Insertion Chr1:26945158 - go to primer design
BLAST e Value 1e-25
Hit Clone Code (BAC ID) F26A9
Hit Gene Code At1g71680 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transmembrane amino acid transporter family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 380B01

Gene hit At1g12120

 
Sequence (A. th genome BLAST matches underlined)
>81-K015788-022-311-A11-8409
GAAGCCTTTACATTGTATAGATATCTTTCGAGAGACATAAGCTATCCCATACCTCCTCTA
GTCTTGCTCAATACGGGATCCTTGCGATAGTGAGGTATCCAGATTATGGTAATCATTCTC
CCAGTTAGAACCCTGGTGTTGCTCTTGATCCGCTCAGAGACCCATGTCGCCTTCTGTCCT
ATCTGAGACTCGCGAGAGTCTGCTCTCTCTTCTCTCTCTATATCGCTCCTCATGATCCGA
TTTTTTATGTAATTTCTCAAACAATTTGTGTGAGAATTACAGATACGCGGTATTTGTGTG
TATATTGATAGAGACCATCGCCATTGGAATCTGACCATGGATCTCGCACCTTCTTGACAT
ATCCTTCATTTCTTTCTCCGGATCTCGACTCCCAGATCTGGTCGGCAACCTCACCATTGG
AGAGCTTCGAGCTTCCTTTGTCTCGCTCTCAGGTGAGTTCCTCAAGTCACAGTATAGTAT
TTATAGATTGGGATTCTTTCCATAGGGATTCTCACGGAAAGGGCGAAGTAGTACTATGTT
TTATGTTCGTCATGAAGTTGATGCTTTTACTTTTCCTCTTATAGTTCCTTCTGTTGAATT
CAGGATTTAGGGATATGTTTATATATCTATCATCCAAATGTGAATATATGTGCGATTGGT
TCTTTTTATGGAATCCATCTCCGAATATTTTTACCTATTTGCATGCTTTTAGAGTTTTAT
TTATAAGCAGAAGCCTGAAGATTTTTGTGTTTTGGATATT
GenBank Accession AL948263 [GenBank]
Graphic View Graphic view of gene At1g12120
Predicted Position of Insertion Chr1:4117712 - go to primer design
BLAST e Value 2e-153
Hit Clone Code (BAC ID) T28K15
Hit Gene Code At1g12120 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant protein of unknown function (DUF863)
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23