SimpleSearch - Line and FST details


Line specific information

 
Line ID 312C03
Vector Used pAC161
Line Availability only available from NASC (N429883)
Segregation Analysis 100:94:93
Confirmed for Hit At3g46010
Parent of DUPLO pair none
Parent of pair(s) 5868, 5870, 5993, 8757, 8788, 10449, 10470, 85502, 85503, 85504, 85505

Gene hit At3g46010

 
Sequence (A. th genome BLAST matches underlined)
>19-K015817-022-312-C03-8409
CTCCCTAACCACTGTTTCTCTTTTTAATTTCAATTTATATATGAATTACCATAACATTTG
GCTGTTGGATCCATTACCCTTGATGAGAGATTCATCAGTTTCATGTAATTGATAATCACT
CTATGGGATCCTCCCTATAGTGAGACNAANNNANCNTANATTTTCTTACAATCGTGACAA
GAGATATCTAGTGCTCTTATCTCAATTGTCGCTCACAAAGTACAGAAGTTCCGATAATAT
CTCAACAATGGTATCCTCCCTATCGATGAGAAGCACTCTCTAAAGAGTAATCTACATTAC
TCCTAAAAGATTAACGTATTTTGTGAGACAACCTCTGTCCATTGATGCCGATGATGGTAT
GGTCTGATCGAAAACATATCGACTACAAAAGGTGACACTTCTATCACATACTCAAAATAG
TGAGAAAAGAATAATTACTGAAATGAGAGA
GenBank Accession AL948408 [GenBank]
Graphic View Graphic view of gene At3g46010
Predicted Position of Insertion Chr3:16910472 - go to primer design
BLAST e Value 2e-21
Hit Clone Code (BAC ID) F16L2
Hit Gene Code At3g46010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation actin depolymerizing factor 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit F4I1

 
Sequence (A. th genome BLAST matches underlined)
>19-K015821-022-312-C03-8409
TATCATGAGATTTCCNGGACATGNAGCCATTTACAATTGATATATCCCAGTGATGATTAA
ACCAACATCAATTGATGATTATATCCAGTTCGATACTCAGATATAACGTCTATTTGCCAA
CATCACAATTTTAACCACTGTTTCTCTTTTTTATTTCCATTTAGAGAGGGACAACCATCC
CCTTCCCCCGAAGGGAAACCTTCACCCATGAGGAAAGATTCATCAGTTTCATGTAATTGA
TAATCACCCTATGGGATCCTCCCTATAGTGAGANNGNNNNCCNNTGNNNNATGGNNTNGA
AAGTAAGNGACATAATAGCGGAAAGATAGATGGAGGACCAACTTCATTGAGCAAAACCCT
TCTATAGCATGCCTCCTATAACCGAAGCCAATATGCCCTATGCGATCCTCCTTACAAAAA
CGCTAACTATAGAAATCTCCCGACACAGAGCAAAACTTCTAGATACAAATTAACCTGCCG
AAAAGGCACACTCTGCTCCGAAGACGTATAGAAAAGAGAGAGACCAGCAACAAATATAAA
CCGAGAAAAAAAACCCCCAAAAGAACAAGCCACAATCCAACTGAAGTCACGCGAACGCGC
GCAATTACCCTGACAATAACCAACATAAAAGGAAATAAACAAAATGAAAGAGAACCAAA
GenBank Accession AL948409 [GenBank]
Graphic View Graphic view of sequence AL948409 of line 312C03
Predicted Position of Insertion Chr2:18352726 - go to primer design
BLAST e Value 7e-18
Hit Clone Code (BAC ID) F4I1
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40